Morpholino

MO1-apobec2b

ID

ZDB-MRPHLNO-090618-2

Name

MO1-apobec2b

Previous Names

Mo(ATG)-Apo2b (1)

Target

apobec2b (1)

Sequence

5' - CTTGCTGTCCTTTTTGTCTGCCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-apobec2b

No data available

Phenotype

Phenotype resulting from MO1-apobec2b

Phenotype	Fish	Figures
axon regeneration decreased process quality, abnormal	WT + MO1-apobec2b	Fig. 9 from Powell et al., 2012
Muller cell cellular potency, abnormal	mi4Tg + MO1-apobec2b	Fig. 5 from Powell et al., 2012
muscle attachment decreased occurrence, abnormal	AB + MO1-apobec2b	Fig. 5 from Etard et al., 2010
myotome malformed, abnormal	AB + MO1-apobec2b	Fig. 5 from Etard et al., 2010
sensory epithelium regeneration decreased process quality, abnormal	WT + MO1-apobec2b	Fig. 5, Fig. 7 from Powell et al., 2012
skeletal muscle cell increased length, abnormal	AB + MO1-apobec2b	Fig. 5 from Etard et al., 2010
skeletal muscle organ development process quality, abnormal	AB + MO1-apobec2b	Fig. 5 from Etard et al., 2010
vertical myoseptum malformed, abnormal	AB + MO1-apobec2b	Fig. 5 from Etard et al., 2010
whole organism curved ventral, abnormal	WT + MO1-apobec2b	Fig. 3 from Powell et al., 2014

Phenotype of all Fish created by or utilizing MO1-apobec2b

Phenotype	Fish	Conditions	Figures
muscle attachment decreased occurrence, abnormal	AB + MO1-apobec2b	standard conditions	Fig. 5 from Etard et al., 2010
vertical myoseptum malformed, abnormal	AB + MO1-apobec2b	standard conditions	Fig. 5 from Etard et al., 2010
myotome malformed, abnormal	AB + MO1-apobec2b	standard conditions	Fig. 5 from Etard et al., 2010
skeletal muscle organ development process quality, abnormal	AB + MO1-apobec2b	standard conditions	Fig. 5 from Etard et al., 2010
skeletal muscle cell increased length, abnormal	AB + MO1-apobec2b	standard conditions	Fig. 5 from Etard et al., 2010
sensory epithelium regeneration decreased process quality, abnormal	WT + MO1-apobec2b	standard conditions	Fig. 7 from Powell et al., 2012
axon regeneration decreased process quality, abnormal	WT + MO1-apobec2b	standard conditions	Fig. 9 from Powell et al., 2012
whole organism curved ventral, abnormal	WT + MO1-apobec2b	standard conditions	Fig. 3 from Powell et al., 2014
sensory epithelium regeneration decreased process quality, abnormal	mi4Tg + MO1-apobec2b	standard conditions	Fig. 5 from Powell et al., 2012
Muller cell cellular potency, abnormal	mi4Tg + MO1-apobec2b	standard conditions	Fig. 5 from Powell et al., 2012
axon regeneration decreased process quality, abnormal	WT + MO1-apobec2a + MO1-apobec2b	standard conditions	Fig. 9 from Powell et al., 2012
retina has fewer parts of type Muller cell, abnormal	WT + MO1-apobec2a + MO1-apobec2b	physical alteration: retina	Fig. 4 from Powell et al., 2014
cell population proliferation decreased occurrence, abnormal	WT + MO1-apobec2a + MO1-apobec2b	physical alteration: anatomical structure	Fig. 5 from Powell et al., 2012
retina regeneration process quality, abnormal	WT + MO1-apobec2a + MO1-apobec2b	physical alteration: retina	Fig. 4 from Powell et al., 2014
sensory epithelium regeneration decreased process quality, abnormal	WT + MO1-apobec2a + MO1-apobec2b	standard conditions	Fig. 5, Fig. 7 from Powell et al., 2012
sensory epithelium regeneration decreased process quality, abnormal	WT + MO1-apobec2a + MO1-apobec2b	physical alteration: anatomical structure	Fig. 5 from Powell et al., 2012
Muller cell cellular potency, abnormal	mi4Tg + MO1-apobec2a + MO1-apobec2b	standard conditions	Fig. 5 from Powell et al., 2012
sensory epithelium regeneration decreased process quality, abnormal	mi4Tg + MO1-apobec2a + MO1-apobec2b	standard conditions	Fig. 5 from Powell et al., 2012
sensory epithelium regeneration decreased process quality, abnormal	mi4Tg + MO1-apobec2a + MO1-apobec2b	physical alteration: anatomical structure	Fig. 5 from Powell et al., 2012
retina regeneration process quality, abnormal	mi42Tg + MO1-apobec2a + MO1-apobec2b	heat shock, physical alteration: retina	Fig. 4 from Powell et al., 2014
retina has fewer parts of type Muller cell, abnormal	mi42Tg + MO1-apobec2a + MO1-apobec2b	heat shock, physical alteration: retina	Fig. 4 from Powell et al., 2014

Citations