Morpholino

MO1-mir15a-1

ID
ZDB-MRPHLNO-090616-7
Name
MO1-mir15a-1
Previous Names
  • MMO-15a-1 (1)
Target
Sequence
5' - TTATAACTCACAAACCATTCTGTGCTGCTAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir15a-1
No data available
Phenotype
Phenotype resulting from MO1-mir15a-1
Phenotype Fish Figures
anterior crista aplastic, abnormal WT + MO1-mir15a-1 Fig. S6 with image from Friedman et al., 2009
hair cell anterior macula decreased amount, abnormal WT + MO1-mir15a-1 Fig. 4 with image from Friedman et al., 2009
inner ear morphogenesis process quality, abnormal WT + MO1-mir15a-1 Fig. 4 with image,  Fig. S6 with image from Friedman et al., 2009
lateral crista aplastic, abnormal WT + MO1-mir15a-1 Fig. S6 with image from Friedman et al., 2009
macula saccule decreased size, abnormal WT + MO1-mir15a-1 Fig. S6 with image from Friedman et al., 2009
macula utricle decreased size, abnormal WT + MO1-mir15a-1 Fig. S6 with image from Friedman et al., 2009
neuromast decreased amount, abnormal WT + MO1-mir15a-1 Fig. 4 with image from Friedman et al., 2009
neuromast hair cell decreased amount, abnormal WT + MO1-mir15a-1 Fig. 4 with image from Friedman et al., 2009
otolith malformed, abnormal WT + MO1-mir15a-1 Fig. 4 with image from Friedman et al., 2009
pillar of the anterior semicircular canal aplastic, abnormal WT + MO1-mir15a-1 Fig. 4 with image from Friedman et al., 2009
pillar of the lateral semicircular canal aplastic, abnormal WT + MO1-mir15a-1 Fig. 4 with image from Friedman et al., 2009
pillar of the posterior semicircular canal aplastic, abnormal WT + MO1-mir15a-1 Fig. 4 with image from Friedman et al., 2009
post-vent region truncated, abnormal WT + MO1-mir15a-1 Fig. S6 with image from Friedman et al., 2009
posterior crista aplastic, abnormal WT + MO1-mir15a-1 Fig. S6 with image from Friedman et al., 2009
semicircular canal morphogenesis arrested, abnormal WT + MO1-mir15a-1 Fig. 4 with image from Friedman et al., 2009
statoacoustic (VIII) ganglion malformed, abnormal WT + MO1-mir15a-1 Fig. S6 with image from Friedman et al., 2009
Phenotype of all Fish created by or utilizing MO1-mir15a-1
Phenotype Fish Conditions Figures
otolith malformed, abnormal WT + MO1-mir15a-1 standard conditions Fig. 4 with image from Friedman et al., 2009
post-vent region truncated, abnormal WT + MO1-mir15a-1 standard conditions Fig. S6 with image from Friedman et al., 2009
neuromast decreased amount, abnormal WT + MO1-mir15a-1 standard conditions Fig. 4 with image from Friedman et al., 2009
semicircular canal morphogenesis arrested, abnormal WT + MO1-mir15a-1 standard conditions Fig. 4 with image from Friedman et al., 2009
posterior crista aplastic, abnormal WT + MO1-mir15a-1 standard conditions Fig. S6 with image from Friedman et al., 2009
lateral crista aplastic, abnormal WT + MO1-mir15a-1 standard conditions Fig. S6 with image from Friedman et al., 2009
pillar of the lateral semicircular canal aplastic, abnormal WT + MO1-mir15a-1 standard conditions Fig. 4 with image from Friedman et al., 2009
anterior crista aplastic, abnormal WT + MO1-mir15a-1 standard conditions Fig. S6 with image from Friedman et al., 2009
neuromast hair cell decreased amount, abnormal WT + MO1-mir15a-1 standard conditions Fig. 4 with image from Friedman et al., 2009
inner ear morphogenesis process quality, abnormal WT + MO1-mir15a-1 standard conditions Fig. 4 with image,  Fig. S6 with image from Friedman et al., 2009
pillar of the posterior semicircular canal aplastic, abnormal WT + MO1-mir15a-1 standard conditions Fig. 4 with image from Friedman et al., 2009
macula saccule decreased size, abnormal WT + MO1-mir15a-1 standard conditions Fig. S6 with image from Friedman et al., 2009
statoacoustic (VIII) ganglion malformed, abnormal WT + MO1-mir15a-1 standard conditions Fig. S6 with image from Friedman et al., 2009
hair cell anterior macula decreased amount, abnormal WT + MO1-mir15a-1 standard conditions Fig. 4 with image from Friedman et al., 2009
pillar of the anterior semicircular canal aplastic, abnormal WT + MO1-mir15a-1 standard conditions Fig. 4 with image from Friedman et al., 2009
macula utricle decreased size, abnormal WT + MO1-mir15a-1 standard conditions Fig. S6 with image from Friedman et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.