Morpholino

MO1-mir18a

ID
ZDB-MRPHLNO-090616-10
Name
MO1-mir18a
Previous Names
  • MMO-18a (1)
Target
Sequence
5' - TACTTCACTATCTGCACTAGATGCACCTTAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir18a
No data available
Phenotype
Phenotype resulting from MO1-mir18a
Phenotype Fish Figures
hair cell anterior macula decreased amount, abnormal WT + MO1-mir18a Fig. 4 with image from Friedman et al., 2009
inner ear has fewer parts of type otolith, abnormal WT + MO1-mir18a Fig. 4 with image from Friedman et al., 2009
inner ear morphogenesis process quality, abnormal WT + MO1-mir18a Fig. 4 with image,  Fig. S6 with image from Friedman et al., 2009
macula saccule decreased size, abnormal WT + MO1-mir18a Fig. S6 with image from Friedman et al., 2009
macula utricle decreased size, abnormal WT + MO1-mir18a Fig. S6 with image from Friedman et al., 2009
neuromast decreased amount, abnormal WT + MO1-mir18a Fig. 4 with image from Friedman et al., 2009
neuromast hair cell decreased amount, abnormal WT + MO1-mir18a Fig. 4 with image from Friedman et al., 2009
otolith decreased amount, abnormal WT + MO1-mir18a Fig. S5 with image from Friedman et al., 2009
otolith decreased size, abnormal WT + MO1-mir18a Fig. 4 with image,  Fig. S5 with image from Friedman et al., 2009
otolith formation process quality, abnormal WT + MO1-mir18a Fig. S5 with image from Friedman et al., 2009
statoacoustic (VIII) ganglion malformed, abnormal WT + MO1-mir18a Fig. S6 with image from Friedman et al., 2009
Phenotype of all Fish created by or utilizing MO1-mir18a
Phenotype Fish Conditions Figures
inner ear morphogenesis process quality, abnormal WT + MO1-mir18a standard conditions Fig. 4 with image,  Fig. S6 with image from Friedman et al., 2009
hair cell anterior macula decreased amount, abnormal WT + MO1-mir18a standard conditions Fig. 4 with image from Friedman et al., 2009
neuromast hair cell decreased amount, abnormal WT + MO1-mir18a standard conditions Fig. 4 with image from Friedman et al., 2009
otolith decreased size, abnormal WT + MO1-mir18a standard conditions Fig. 4 with image,  Fig. S5 with image from Friedman et al., 2009
otolith decreased amount, abnormal WT + MO1-mir18a standard conditions Fig. S5 with image from Friedman et al., 2009
macula utricle decreased size, abnormal WT + MO1-mir18a standard conditions Fig. S6 with image from Friedman et al., 2009
otolith formation process quality, abnormal WT + MO1-mir18a standard conditions Fig. S5 with image from Friedman et al., 2009
neuromast decreased amount, abnormal WT + MO1-mir18a standard conditions Fig. 4 with image from Friedman et al., 2009
macula saccule decreased size, abnormal WT + MO1-mir18a standard conditions Fig. S6 with image from Friedman et al., 2009
statoacoustic (VIII) ganglion malformed, abnormal WT + MO1-mir18a standard conditions Fig. S6 with image from Friedman et al., 2009
inner ear has fewer parts of type otolith, abnormal WT + MO1-mir18a standard conditions Fig. 4 with image from Friedman et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.