Morpholino

MO2-pld1a

ID
ZDB-MRPHLNO-090528-2
Name
MO2-pld1a
Previous Names
  • MO2-pld1 (1)
Target
Sequence
5' - TGTCTCATCACCTCTTAAGAAAGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the intron-exon junction of the exon coding the first HKD motif.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pld1a
Expressed Gene Anatomy Figures
gata1a Fig. S6 with image from Zeng et al., 2009
pld1a Fig. 3 with image from Zeng et al., 2009
Phenotype
Phenotype resulting from MO2-pld1a
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO2-pld1a Fig. 4 with image,  Fig. 7 with image from Zeng et al., 2009
cerebellar central artery disorganized, abnormal zn1Tg + MO2-pld1a Fig. S6 with image from Zeng et al., 2009
erythrocyte differentiation disrupted, abnormal WT + MO2-pld1a Fig. S6 with image from Zeng et al., 2009
inner optic circle decreased amount, abnormal zn1Tg + MO2-pld1a Fig. S6 with image from Zeng et al., 2009
intersegmental vessel irregular spatial pattern, abnormal WT + MO2-pld1a Fig. 4 with image from Zeng et al., 2009
intersegmental vessel morphology, abnormal y1Tg + MO2-pld1a Fig. 4 with image,  Fig. 7 with image from Zeng et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO2-pld1a Fig. S6 with image from Zeng et al., 2009
primary motor neuron branched, abnormal y1Tg + MO2-pld1a Fig. 7 with image from Zeng et al., 2009
vasculogenesis disrupted, abnormal zn1Tg + MO2-pld1a Fig. S6 with image from Zeng et al., 2009
Phenotype of all Fish created by or utilizing MO2-pld1a
Phenotype Fish Conditions Figures
angiogenesis disrupted, abnormal WT + MO1-pld1a + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
intersegmental vessel morphology, abnormal WT + MO1-pld1a + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
intersegmental vessel irregular spatial pattern, abnormal WT + MO1-pld1a + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
intersegmental vessel irregular spatial pattern, abnormal WT + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
angiogenesis disrupted, abnormal WT + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
erythrocyte differentiation disrupted, abnormal WT + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
intersegmental vessel morphology, abnormal WT + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
intersegmental vessel morphology, abnormal y1Tg + MO2-pld1a standard conditions Fig. 7 with image from Zeng et al., 2009
primary motor neuron branched, abnormal y1Tg + MO2-pld1a standard conditions Fig. 7 with image from Zeng et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO2-pld1a standard conditions Fig. 7 with image from Zeng et al., 2009
vasculogenesis disrupted, abnormal zn1Tg + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
cerebellar central artery disorganized, abnormal zn1Tg + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
inner optic circle decreased amount, abnormal zn1Tg + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.