Morpholino

MO2-dcn

ID
ZDB-MRPHLNO-090513-6
Name
MO2-dcn
Previous Names
  • Dcn-MOsplice (1)
Target
Sequence
5' - GCAGACCTGGGCATTTTGACACAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Designed to target/block a dcn splice junction.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dcn
No data available
Phenotype
Phenotype resulting from MO2-dcn
Phenotype Fish Figures
cartilage development disrupted, abnormal WT + MO2-dcn Fig. 6 from Zoeller et al., 2009
ceratobranchial cartilage decreased amount, abnormal WT + MO2-dcn Fig. 6 from Zoeller et al., 2009
ceratohyal cartilage decreased length, abnormal WT + MO2-dcn Fig. 6 from Zoeller et al., 2009
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-dcn Fig. 5,  Fig. 7 from Zoeller et al., 2009
Meckel's cartilage decreased length, abnormal WT + MO2-dcn Fig. 6 from Zoeller et al., 2009
palatoquadrate cartilage decreased length, abnormal WT + MO2-dcn Fig. 6 from Zoeller et al., 2009
pharyngeal arch cartilage bent, abnormal WT + MO2-dcn Fig. 6 from Zoeller et al., 2009
pharyngeal arch cartilage condensed, abnormal WT + MO2-dcn Fig. 6 from Zoeller et al., 2009
post-vent region decreased length, abnormal WT + MO2-dcn Fig. 5,  Fig. 7 from Zoeller et al., 2009
trunk decreased length, abnormal WT + MO2-dcn Fig. 5,  Fig. 7 from Zoeller et al., 2009
whole organism decreased length, abnormal WT + MO2-dcn Fig. 5 from Zoeller et al., 2009
Phenotype of all Fish created by or utilizing MO2-dcn
Phenotype Fish Conditions Figures
pharyngeal arch cartilage bent, abnormal WT + MO2-dcn standard conditions Fig. 6 from Zoeller et al., 2009
ceratohyal cartilage decreased length, abnormal WT + MO2-dcn standard conditions Fig. 6 from Zoeller et al., 2009
pharyngeal arch cartilage condensed, abnormal WT + MO2-dcn standard conditions Fig. 6 from Zoeller et al., 2009
ceratobranchial cartilage decreased amount, abnormal WT + MO2-dcn standard conditions Fig. 6 from Zoeller et al., 2009
whole organism decreased length, abnormal WT + MO2-dcn standard conditions Fig. 5 from Zoeller et al., 2009
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-dcn standard conditions Fig. 5,  Fig. 7 from Zoeller et al., 2009
cartilage development disrupted, abnormal WT + MO2-dcn standard conditions Fig. 6 from Zoeller et al., 2009
post-vent region decreased length, abnormal WT + MO2-dcn standard conditions Fig. 5,  Fig. 7 from Zoeller et al., 2009
palatoquadrate cartilage decreased length, abnormal WT + MO2-dcn standard conditions Fig. 6 from Zoeller et al., 2009
trunk decreased length, abnormal WT + MO2-dcn standard conditions Fig. 5,  Fig. 7 from Zoeller et al., 2009
Meckel's cartilage decreased length, abnormal WT + MO2-dcn standard conditions Fig. 6 from Zoeller et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.