Morpholino

MO2-cald1b

ID
ZDB-MRPHLNO-090413-2
Name
MO2-cald1b
Previous Names
None
Target
Sequence
5' - TAAGAGTTCATCCTGTAGAGTGATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cald1b
No data available
Phenotype
Phenotype resulting from MO2-cald1b
Phenotype Fish Figures
angiogenesis disrupted, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
atrioventricular valve aplastic, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
atrium elongated, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
atrium increased size, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
blood circulation decreased occurrence, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
blood circulation disrupted, abnormal WT + MO2-cald1b text only from Zheng et al., 2009
cardiac conduction system development disrupted, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
cardiac muscle cell decreased amount, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
cardiac muscle cell decreased size, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
cardiac muscle cell proliferation disrupted, abnormal WT + MO2-cald1b Fig. 1,  text only from Zheng et al., 2009
cardiac ventricle elongated, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
heart contractility, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
heart decreased functionality, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
heart morphology, abnormal WT + MO2-cald1b Fig. 1,  text only from Zheng et al., 2009
heart contraction decreased rate, abnormal WT + MO2-cald1b text only from Zheng et al., 2009
Fig. 1 from Zheng et al., 2009
heart contraction irregular rhythm, abnormal WT + MO2-cald1b text only from Zheng et al., 2009
Fig. 1 from Zheng et al., 2009
heart looping disrupted, abnormal WT + MO2-cald1b Fig. 1,  text only from Zheng et al., 2009
heart morphogenesis disrupted, abnormal WT + MO2-cald1b Fig. 1,  text only from Zheng et al., 2009
pericardium edematous, abnormal WT + MO2-cald1b Fig. 1,  text only from Zheng et al., 2009
subintestinal vein decreased functionality, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
subintestinal vein structure, abnormal WT + MO2-cald1b Fig. 1 from Zheng et al., 2009
Phenotype of all Fish created by or utilizing MO2-cald1b
Phenotype Fish Conditions Figures
heart contraction decreased rate, abnormal WT + MO2-cald1b standard conditions text only from Zheng et al., 2009
Fig. 1 from Zheng et al., 2009
heart contractility, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
atrioventricular valve aplastic, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
atrium increased size, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
cardiac muscle cell decreased amount, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
cardiac muscle cell proliferation disrupted, abnormal WT + MO2-cald1b standard conditions Fig. 1,  text only from Zheng et al., 2009
cardiac muscle cell decreased size, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
heart decreased functionality, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
subintestinal vein decreased functionality, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
blood circulation decreased occurrence, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
heart morphogenesis disrupted, abnormal WT + MO2-cald1b standard conditions Fig. 1,  text only from Zheng et al., 2009
subintestinal vein structure, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
blood circulation disrupted, abnormal WT + MO2-cald1b standard conditions text only from Zheng et al., 2009
heart morphology, abnormal WT + MO2-cald1b standard conditions Fig. 1,  text only from Zheng et al., 2009
pericardium edematous, abnormal WT + MO2-cald1b standard conditions Fig. 1,  text only from Zheng et al., 2009
atrium elongated, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
cardiac ventricle elongated, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
heart looping disrupted, abnormal WT + MO2-cald1b standard conditions Fig. 1,  text only from Zheng et al., 2009
cardiac conduction system development disrupted, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
heart contraction irregular rhythm, abnormal WT + MO2-cald1b standard conditions text only from Zheng et al., 2009
Fig. 1 from Zheng et al., 2009
angiogenesis disrupted, abnormal WT + MO2-cald1b standard conditions Fig. 1 from Zheng et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.