Morpholino

MO4-tbx5a

ID

ZDB-MRPHLNO-090227-1

Name

MO4-tbx5a

Previous Names

MO4-tbx5 (1)
tbx5-MO(2) (1)

Target

tbx5a (1)

Sequence

5' - GCCTGTACGATGTCTACCGTGAGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets upstream of the tbx5 translation start site.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-tbx5a

No data available

Phenotype

Phenotype resulting from MO4-tbx5a

Phenotype	Fish	Figures
heart edematous, abnormal	tbx5a^{tpl148/tpl148} + MO4-tbx5a	Figure 1 from Cunningham et al., 2020
heart morphology, abnormal	WT + MO4-tbx5a	text only from Lu et al., 2008
heart structure, abnormal	WT + MO4-tbx5a	Fig. 10 from Parrie et al., 2013
heart development disrupted, abnormal	WT + MO4-tbx5a	Fig. 10 from Parrie et al., 2013
heart looping disrupted, abnormal	WT + MO4-tbx5a	text only from Lu et al., 2008
pectoral fin absent, abnormal	tbx5a^{tpl148/tpl148} + MO4-tbx5a	Figure 1 from Cunningham et al., 2020
pectoral fin aplastic, abnormal	WT + MO4-tbx5a	Fig. 11 from Parrie et al., 2013
pectoral fin malformed, abnormal	tbx5a^{tpl148/tpl148} + MO4-tbx5a	Figure 1 from Cunningham et al., 2020
pectoral fin development disrupted, abnormal	WT + MO4-tbx5a	Fig. 11 from Parrie et al., 2013
pericardium edematous, abnormal	WT + MO4-tbx5a	text only from Lu et al., 2008

Phenotype of all Fish created by or utilizing MO4-tbx5a

Phenotype	Fish	Conditions	Figures
pectoral fin absent, abnormal	tbx5a^{tpl147/tpl147} + MO4-tbx5a	standard conditions	Figure 1 from Cunningham et al., 2020
pectoral fin malformed, abnormal	tbx5a^{tpl147/tpl147} + MO4-tbx5a	standard conditions	Figure 1 from Cunningham et al., 2020
heart edematous, abnormal	tbx5a^{tpl147/tpl147} + MO4-tbx5a	standard conditions	Figure 1 from Cunningham et al., 2020
pectoral fin malformed, abnormal	tbx5a^{tpl148/tpl148} + MO4-tbx5a	standard conditions	Figure 1 from Cunningham et al., 2020
pectoral fin absent, abnormal	tbx5a^{tpl148/tpl148} + MO4-tbx5a	standard conditions	Figure 1 from Cunningham et al., 2020
heart edematous, abnormal	tbx5a^{tpl148/tpl148} + MO4-tbx5a	standard conditions	Figure 1 from Cunningham et al., 2020
pectoral fin malformed, abnormal	WT + MO4-tbx5a	standard conditions	Figure 1 from Cunningham et al., 2020
pectoral fin development disrupted, abnormal	WT + MO4-tbx5a	standard conditions	Fig. 11 from Parrie et al., 2013
heart looping disrupted, abnormal	WT + MO4-tbx5a	standard conditions	text only from Lu et al., 2008
pectoral fin absent, abnormal	WT + MO4-tbx5a	standard conditions	Figure 1 from Cunningham et al., 2020
pericardium edematous, abnormal	WT + MO4-tbx5a	standard conditions	text only from Lu et al., 2008
heart structure, abnormal	WT + MO4-tbx5a	standard conditions	Fig. 10 from Parrie et al., 2013
heart morphology, abnormal	WT + MO4-tbx5a	standard conditions	text only from Lu et al., 2008
heart development disrupted, abnormal	WT + MO4-tbx5a	standard conditions	Fig. 10 from Parrie et al., 2013
pectoral fin aplastic, abnormal	WT + MO4-tbx5a	standard conditions	Fig. 11 from Parrie et al., 2013
heart edematous, abnormal	WT + MO4-tbx5a	standard conditions	Figure 1 from Cunningham et al., 2020

Citations