Morpholino

MO1-eya4

ID

ZDB-MRPHLNO-081231-4

Name

MO1-eya4

Previous Names

MO3eya4 (1)

Target

eya4 (1)

Sequence

5' - TACTGATGTTACCTGTTGTCTACTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-eya4

No data available

Phenotype

Phenotype resulting from MO1-eya4

Phenotype	Fish	Figures
hair cell anterior macula decreased amount, abnormal	AB + MO1-eya4	Fig. 4 from Wang et al., 2008
hair cell anterior macula stereocilium decreased amount, abnormal	AB + MO1-eya4	Fig. 4 from Wang et al., 2008
hair cell anterior macula stereocilium malformed, abnormal	AB + MO1-eya4	Fig. 4 from Wang et al., 2008
inner ear morphogenesis disrupted, abnormal	AB + MO1-eya4	Fig. 2 , Fig. 3 from Wang et al., 2008
otic vesicle decreased size, abnormal	AB + MO1-eya4	Fig. 2 , Fig. 3 from Wang et al., 2008
otic vesicle shape, abnormal	AB + MO1-eya4	Fig. 2 , Fig. 3 from Wang et al., 2008
pillar of the anterior semicircular canal malformed, abnormal	AB + MO1-eya4	Fig. 2 , Fig. 3 from Wang et al., 2008
pillar of the lateral semicircular canal malformed, abnormal	AB + MO1-eya4	Fig. 2 , Fig. 3 from Wang et al., 2008
pillar of the posterior semicircular canal malformed, abnormal	AB + MO1-eya4	Fig. 2 , Fig. 3 from Wang et al., 2008
posterior lateral line neuromast decreased amount, abnormal	AB + MO1-eya4	Fig. 5 from Wang et al., 2008
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal	AB + MO1-eya4	Fig. 5 from Wang et al., 2008
posterior lateral line neuromast development disrupted, abnormal	AB + MO1-eya4	Fig. 5 from Wang et al., 2008
semicircular canal malformed, abnormal	AB + MO1-eya4	Fig. 2 , Fig. 3 from Wang et al., 2008

Phenotype of all Fish created by or utilizing MO1-eya4

Phenotype	Fish	Conditions	Figures
hair cell anterior macula stereocilium decreased amount, abnormal	AB + MO1-eya4	standard conditions	Fig. 4 from Wang et al., 2008
inner ear morphogenesis disrupted, abnormal	AB + MO1-eya4	standard conditions	Fig. 2 , Fig. 3 from Wang et al., 2008
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal	AB + MO1-eya4	standard conditions	Fig. 5 from Wang et al., 2008
pillar of the posterior semicircular canal malformed, abnormal	AB + MO1-eya4	standard conditions	Fig. 2 , Fig. 3 from Wang et al., 2008
hair cell anterior macula decreased amount, abnormal	AB + MO1-eya4	standard conditions	Fig. 4 from Wang et al., 2008
otic vesicle shape, abnormal	AB + MO1-eya4	standard conditions	Fig. 2 , Fig. 3 from Wang et al., 2008
pillar of the anterior semicircular canal malformed, abnormal	AB + MO1-eya4	standard conditions	Fig. 2 , Fig. 3 from Wang et al., 2008
otic vesicle decreased size, abnormal	AB + MO1-eya4	standard conditions	Fig. 2 , Fig. 3 from Wang et al., 2008
hair cell anterior macula stereocilium malformed, abnormal	AB + MO1-eya4	standard conditions	Fig. 4 from Wang et al., 2008
semicircular canal malformed, abnormal	AB + MO1-eya4	standard conditions	Fig. 2 , Fig. 3 from Wang et al., 2008
posterior lateral line neuromast development disrupted, abnormal	AB + MO1-eya4	standard conditions	Fig. 5 from Wang et al., 2008
posterior lateral line neuromast decreased amount, abnormal	AB + MO1-eya4	standard conditions	Fig. 5 from Wang et al., 2008
pillar of the lateral semicircular canal malformed, abnormal	AB + MO1-eya4	standard conditions	Fig. 2 , Fig. 3 from Wang et al., 2008

Citations