Morpholino

MO1-eya4

ID
ZDB-MRPHLNO-081231-4
Name
MO1-eya4
Previous Names
  • MO3eya4 (1)
Target
Sequence
5' - TACTGATGTTACCTGTTGTCTACTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-eya4
Expressed Gene Anatomy Figures
atp1a1a.1 Fig. 6 with image from Wang et al., 2008
atp1a1a.2 Fig. 6 with image from Wang et al., 2008
atp1a1a.4 Fig. 6 with image from Wang et al., 2008
atp1a1a.5 Fig. 6 with image from Wang et al., 2008
atp1b1a Fig. 6 with image from Wang et al., 2008
atp1b2b Fig. 6 with image from Wang et al., 2008
eya1 Fig. 6 with image from Wang et al., 2008
Phenotype
Phenotype resulting from MO1-eya4
Phenotype Fish Figures
hair cell anterior macula decreased amount, abnormal AB + MO1-eya4 Fig. 4 with image from Wang et al., 2008
hair cell anterior macula stereocilium decreased amount, abnormal AB + MO1-eya4 Fig. 4 with image from Wang et al., 2008
hair cell anterior macula stereocilium malformed, abnormal AB + MO1-eya4 Fig. 4 with image from Wang et al., 2008
inner ear morphogenesis disrupted, abnormal AB + MO1-eya4 Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
otic vesicle decreased size, abnormal AB + MO1-eya4 Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
otic vesicle shape, abnormal AB + MO1-eya4 Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
pillar of the anterior semicircular canal malformed, abnormal AB + MO1-eya4 Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
pillar of the lateral semicircular canal malformed, abnormal AB + MO1-eya4 Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
pillar of the posterior semicircular canal malformed, abnormal AB + MO1-eya4 Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
posterior lateral line neuromast decreased amount, abnormal AB + MO1-eya4 Fig. 5 with image from Wang et al., 2008
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal AB + MO1-eya4 Fig. 5 with image from Wang et al., 2008
posterior lateral line neuromast development disrupted, abnormal AB + MO1-eya4 Fig. 5 with image from Wang et al., 2008
semicircular canal malformed, abnormal AB + MO1-eya4 Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
Phenotype of all Fish created by or utilizing MO1-eya4
Phenotype Fish Conditions Figures
hair cell anterior macula stereocilium decreased amount, abnormal AB + MO1-eya4 standard conditions Fig. 4 with image from Wang et al., 2008
inner ear morphogenesis disrupted, abnormal AB + MO1-eya4 standard conditions Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal AB + MO1-eya4 standard conditions Fig. 5 with image from Wang et al., 2008
pillar of the posterior semicircular canal malformed, abnormal AB + MO1-eya4 standard conditions Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
hair cell anterior macula decreased amount, abnormal AB + MO1-eya4 standard conditions Fig. 4 with image from Wang et al., 2008
otic vesicle shape, abnormal AB + MO1-eya4 standard conditions Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
pillar of the anterior semicircular canal malformed, abnormal AB + MO1-eya4 standard conditions Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
otic vesicle decreased size, abnormal AB + MO1-eya4 standard conditions Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
hair cell anterior macula stereocilium malformed, abnormal AB + MO1-eya4 standard conditions Fig. 4 with image from Wang et al., 2008
semicircular canal malformed, abnormal AB + MO1-eya4 standard conditions Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
posterior lateral line neuromast development disrupted, abnormal AB + MO1-eya4 standard conditions Fig. 5 with image from Wang et al., 2008
posterior lateral line neuromast decreased amount, abnormal AB + MO1-eya4 standard conditions Fig. 5 with image from Wang et al., 2008
pillar of the lateral semicircular canal malformed, abnormal AB + MO1-eya4 standard conditions Fig. 2 with image,  Fig. 3 with image from Wang et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.