Morpholino

MO3-lclat1

ID
ZDB-MRPHLNO-081110-3
Name
MO3-lclat1
Previous Names
  • lycat-MO3 (1)
  • MO3-lycat (1)
Target
Sequence
5' - CTGAACACACACACTGACCGAAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-lclat1
Expressed Gene Anatomy Figures
etsrp Fig. 3,  Fig. S3 from Xiong et al., 2008
etv6 Fig. 1 from Rasighaemi et al., 2015
fli1 Fig. 3 from Xiong et al., 2008
gata1a Fig. 4 from Xiong et al., 2008
kdrl Fig. 3 from Xiong et al., 2008
lmo2 Fig. 4 from Xiong et al., 2008
tal1 Fig. 1 from Rasighaemi et al., 2015
Fig. 4 from Xiong et al., 2008
tie1 Fig. S3 from Xiong et al., 2008
Phenotype
Phenotype resulting from MO3-lclat1
Phenotype Fish Figures
blood cell decreased amount, abnormal WT + MO3-lclat1 Fig. 1 from Xiong et al., 2008
blood vasculature decreased amount, abnormal WT + MO3-lclat1 Fig. 1 from Xiong et al., 2008
blood vessel development disrupted, abnormal zf528Tg + MO3-lclat1 Fig. 1,  Fig. S2,  Fig. S3 from Xiong et al., 2008
endocardium aplastic, abnormal zf528Tg + MO3-lclat1 Fig. 1,  Fig. S2 from Xiong et al., 2008
endothelial cell decreased amount, abnormal zf528Tg + MO3-lclat1 Fig. S2 from Xiong et al., 2008
endothelial cell development disrupted, abnormal zf528Tg + MO3-lclat1 Fig. S2 from Xiong et al., 2008
intermediate cell mass of mesoderm etv6 expression decreased amount, abnormal WT + MO3-lclat1 Fig. 1 from Rasighaemi et al., 2015
intermediate cell mass of mesoderm tal1 expression decreased amount, abnormal WT + MO3-lclat1 Fig. 1 from Rasighaemi et al., 2015
Phenotype of all Fish created by or utilizing MO3-lclat1
Phenotype Fish Conditions Figures
blood cell decreased amount, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
blood vessel development disrupted, abnormal WT + MO3-lclat1 standard conditions Fig. 1,  Fig. S3 from Xiong et al., 2008
intermediate cell mass of mesoderm etv6 expression decreased amount, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Rasighaemi et al., 2015
blood vasculature decreased amount, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
endocardium aplastic, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
intermediate cell mass of mesoderm tal1 expression decreased amount, abnormal WT + MO3-lclat1 standard conditions Fig. 1 from Rasighaemi et al., 2015
blood vessel development disrupted, abnormal la781Tg + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
blood vasculature decreased amount, abnormal la781Tg + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
endothelial cell decreased amount, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. S2 from Xiong et al., 2008
blood vessel development disrupted, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. 1,  Fig. S2 from Xiong et al., 2008
endocardium aplastic, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. S2 from Xiong et al., 2008
endothelial cell development disrupted, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. S2 from Xiong et al., 2008
blood vasculature decreased amount, abnormal zf528Tg + MO3-lclat1 standard conditions Fig. 1 from Xiong et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.