Morpholino
MO1-atp6v0b
- ID
- ZDB-MRPHLNO-081014-1
- Name
- MO1-atp6v0b
- Previous Names
- None
- Target
- Sequence
-
5' - AAGGTTTTATTAGCACTTACCGACG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking morpholino targeting the exon1/intron1 junction.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atp6v0b
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| atp6v0b |
Fig. 8 
from Lee et al., 2008 |
Phenotype
Phenotype resulting from MO1-atp6v0b
| Phenotype | Fish | Figures |
|---|---|---|
| eye discolored, abnormal | AB + MO1-atp6v0b |
Fig. 8
from Lee et al., 2008 |
| integument colorless, abnormal | AB + MO1-atp6v0b |
Fig. 8
from Lee et al., 2008 |
| retina degenerate, abnormal | AB + MO1-atp6v0b |
Fig. 8
from Lee et al., 2008 |
Phenotype of all Fish created by or utilizing MO1-atp6v0b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| eye discolored, abnormal | AB + MO1-atp6v0b | standard conditions |
Fig. 8
from Lee et al., 2008 |
| integument colorless, abnormal | AB + MO1-atp6v0b | standard conditions |
Fig. 8
from Lee et al., 2008 |
| retina degenerate, abnormal | AB + MO1-atp6v0b | standard conditions |
Fig. 8
from Lee et al., 2008 |
Citations