Morpholino

MO2-six2a

ID

ZDB-MRPHLNO-080919-3

Name

MO2-six2a

Previous Names

Target

Sequence

5' - TTGTCTCAAAAATAAACGTCCCTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-six2a

Expressed Gene	Anatomy	Figures
pax2a	pronephric mesoderm	Fig. 6 from Weber et al., 2008
wt1a	pronephric glomerulus pronephric mesoderm pronephric tubule	Fig. 6, Fig. 7 from Weber et al., 2008

Phenotype

Phenotype resulting from MO2-six2a

Phenotype	Fish	Figures
head aplastic, abnormal	WT + MO2-six2a	text only from Weber et al., 2008
head decreased size, abnormal	WT + MO2-six2a	text only from Weber et al., 2008
intermediate cell mass of mesoderm increased width, abnormal	WT + MO2-six2a	text only from Weber et al., 2008
notochord aplastic, abnormal	WT + MO2-six2a	text only from Weber et al., 2008
polarity specification of dorsal/ventral axis disrupted, abnormal	WT + MO2-six2a	text only from Weber et al., 2008
pronephric glomerulus morphology, abnormal	WT + MO2-six2a	Fig. 6, Fig. 7 from Weber et al., 2008
pronephros development disrupted, abnormal	WT + MO2-six2a	Fig. 6, Fig. 7 from Weber et al., 2008
whole organism spindle-shaped, abnormal	WT + MO2-six2a	text only from Weber et al., 2008
whole organism wholly ventralized, abnormal	WT + MO2-six2a	text only from Weber et al., 2008

Phenotype of all Fish created by or utilizing MO2-six2a

Phenotype	Fish	Conditions	Figures
head decreased size, abnormal	WT + MO2-six2a	standard conditions	text only from Weber et al., 2008
pronephric glomerulus morphology, abnormal	WT + MO2-six2a	standard conditions	Fig. 6, Fig. 7 from Weber et al., 2008
polarity specification of dorsal/ventral axis disrupted, abnormal	WT + MO2-six2a	standard conditions	text only from Weber et al., 2008
whole organism spindle-shaped, abnormal	WT + MO2-six2a	standard conditions	text only from Weber et al., 2008
intermediate cell mass of mesoderm increased width, abnormal	WT + MO2-six2a	standard conditions	text only from Weber et al., 2008
pronephros development disrupted, abnormal	WT + MO2-six2a	standard conditions	Fig. 6, Fig. 7 from Weber et al., 2008
whole organism wholly ventralized, abnormal	WT + MO2-six2a	standard conditions	text only from Weber et al., 2008
notochord aplastic, abnormal	WT + MO2-six2a	standard conditions	text only from Weber et al., 2008
head aplastic, abnormal	WT + MO2-six2a	standard conditions	text only from Weber et al., 2008

Citations