Morpholino

MO2-mych

ID

ZDB-MRPHLNO-080822-4

Name

MO2-mych

Previous Names

Target

Sequence

5' - GCAAAAGACTCACCAGAATCGCTAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the splicing donor region of intron between exon 1 and exon 2 of mych.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-mych

Expressed Gene	Anatomy	Figures
foxd3	cranial neural crest	Fig. 6 from Hong et al., 2008

Phenotype

Phenotype resulting from MO2-mych

Phenotype	Fish	Figures
head decreased size, abnormal	AB + MO2-mych	Fig. 3 from Hong et al., 2008
neural crest decreased thickness, abnormal	AB + MO2-mych	Fig. 6 from Hong et al., 2008
neural crest cell decreased amount, abnormal	AB + MO2-mych	Fig. 6 from Hong et al., 2008
neural crest cell fate specification disrupted, abnormal	AB + MO2-mych	Fig. 6 from Hong et al., 2008
trunk decreased length, abnormal	AB + MO2-mych	Fig. 3 from Hong et al., 2008

Phenotype of all Fish created by or utilizing MO2-mych

Phenotype	Fish	Conditions	Figures
trunk decreased length, abnormal	AB + MO1-mych + MO2-mych	standard conditions	Fig. 3 from Hong et al., 2008
neural crest cell fate specification disrupted, abnormal	AB + MO1-mych + MO2-mych	standard conditions	Fig. 6 from Hong et al., 2008
neural crest cell decreased amount, abnormal	AB + MO1-mych + MO2-mych	standard conditions	Fig. 6 from Hong et al., 2008
neural crest decreased thickness, abnormal	AB + MO1-mych + MO2-mych	standard conditions	Fig. 6 from Hong et al., 2008
head decreased size, abnormal	AB + MO1-mych + MO2-mych	standard conditions	Fig. 3 from Hong et al., 2008
neural crest cell fate specification disrupted, abnormal	AB + MO2-mych	standard conditions	Fig. 6 from Hong et al., 2008
neural crest cell decreased amount, abnormal	AB + MO2-mych	standard conditions	Fig. 6 from Hong et al., 2008
neural crest decreased thickness, abnormal	AB + MO2-mych	standard conditions	Fig. 6 from Hong et al., 2008
trunk decreased length, abnormal	AB + MO2-mych	standard conditions	Fig. 3 from Hong et al., 2008
head decreased size, abnormal	AB + MO2-mych	standard conditions	Fig. 3 from Hong et al., 2008

Citations