Morpholino

MO3-hspg2

ID

ZDB-MRPHLNO-080807-3

Name

MO3-hspg2

Previous Names

DV-MO (1)

Target

hspg2 (1)

Sequence

5' - CATCAAACCTGCAAAAGAAAAATGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-hspg2

No data available

Phenotype

Phenotype resulting from MO3-hspg2

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	y1Tg + MO3-hspg2	Fig. S5 from Zoeller et al., 2008
cardiovascular system morphology, abnormal	WT + MO3-hspg2	Fig. S2 from Zoeller et al., 2008
dorsal aorta collapsed, abnormal	WT + MO3-hspg2	Fig. 4 from Zoeller et al., 2008
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO3-hspg2	Fig. S5 from Zoeller et al., 2008
intersegmental vessel decreased length, abnormal	y1Tg + MO3-hspg2	Fig. S5 from Zoeller et al., 2008
myoseptum U-shaped, abnormal	WT + MO3-hspg2	Fig. 4 from Zoeller et al., 2008
myotome morphology, abnormal	WT + MO3-hspg2	Fig. 4 from Zoeller et al., 2008
myotome vacuolated, abnormal	WT + MO3-hspg2	Fig. 4 from Zoeller et al., 2008
post-vent region curved dorsal, abnormal	WT + MO3-hspg2	Fig. S2 from Zoeller et al., 2008
skeletal muscle tissue development disrupted, abnormal	WT + MO3-hspg2	Fig. 4 from Zoeller et al., 2008
skeletal myofibril assembly disrupted, abnormal	WT + MO3-hspg2	Fig. 5 from Zoeller et al., 2008
trunk kinked, abnormal	WT + MO3-hspg2	Fig. S2 from Zoeller et al., 2008
trunk musculature dystrophic, abnormal	WT + MO3-hspg2	Fig. 5 from Zoeller et al., 2008
trunk musculature myofibril misaligned with trunk musculature myofibril, abnormal	WT + MO3-hspg2	Fig. 5 from Zoeller et al., 2008
trunk musculature striated muscle thin filament decreased amount, abnormal	WT + MO3-hspg2	Fig. 5 from Zoeller et al., 2008
whole organism decreased length, abnormal	WT + MO3-hspg2	Fig. S2 from Zoeller et al., 2008

Phenotype of all Fish created by or utilizing MO3-hspg2

Phenotype	Fish	Conditions	Figures
trunk musculature striated muscle thin filament decreased amount, abnormal	WT + MO3-hspg2	standard conditions	Fig. 5 from Zoeller et al., 2008
trunk kinked, abnormal	WT + MO3-hspg2	standard conditions	Fig. S2 from Zoeller et al., 2008
myotome vacuolated, abnormal	WT + MO3-hspg2	standard conditions	Fig. 4 from Zoeller et al., 2008
skeletal myofibril assembly disrupted, abnormal	WT + MO3-hspg2	standard conditions	Fig. 5 from Zoeller et al., 2008
cardiovascular system morphology, abnormal	WT + MO3-hspg2	standard conditions	Fig. S2 from Zoeller et al., 2008
myotome morphology, abnormal	WT + MO3-hspg2	standard conditions	Fig. 4 from Zoeller et al., 2008
trunk musculature myofibril misaligned with trunk musculature myofibril, abnormal	WT + MO3-hspg2	standard conditions	Fig. 5 from Zoeller et al., 2008
trunk musculature dystrophic, abnormal	WT + MO3-hspg2	standard conditions	Fig. 5 from Zoeller et al., 2008
whole organism decreased length, abnormal	WT + MO3-hspg2	standard conditions	Fig. S2 from Zoeller et al., 2008
dorsal aorta collapsed, abnormal	WT + MO3-hspg2	standard conditions	Fig. 4 from Zoeller et al., 2008
skeletal muscle tissue development disrupted, abnormal	WT + MO3-hspg2	standard conditions	Fig. 4 from Zoeller et al., 2008
myoseptum U-shaped, abnormal	WT + MO3-hspg2	standard conditions	Fig. 4 from Zoeller et al., 2008
post-vent region curved dorsal, abnormal	WT + MO3-hspg2	standard conditions	Fig. S2 from Zoeller et al., 2008
intersegmental vessel decreased length, abnormal	y1Tg + MO3-hspg2	standard conditions	Fig. S5 from Zoeller et al., 2008
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO3-hspg2	standard conditions	Fig. S5 from Zoeller et al., 2008
angiogenesis disrupted, abnormal	y1Tg + MO3-hspg2	standard conditions	Fig. S5 from Zoeller et al., 2008

Citations