Morpholino

MO3-mif

ID
ZDB-MRPHLNO-080708-6
Name
MO3-mif
Previous Names
None
Target
Sequence
5' - GCGATGTACGTCACACAGACAAAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a splice blocking morpholino that targets mif.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mif
Expressed Gene Anatomy Figures
pcna Fig. 4 from Ito et al., 2008
Phenotype
Phenotype resulting from MO3-mif
Phenotype Fish Figures
amacrine cell decreased amount, abnormal WT + MO3-mif Fig. 4 from Ito et al., 2008
cell population proliferation disrupted, abnormal WT + MO3-mif Fig. 4 from Ito et al., 2008
eye decreased size, abnormal WT + MO3-mif Fig. 3,  text only from Ito et al., 2008
eye malformed, abnormal WT + MO3-mif Fig. 3,  text only from Ito et al., 2008
fourth ventricle increased size, abnormal WT + MO3-mif Fig. 3 from Ito et al., 2008
head decreased size, abnormal WT + MO3-mif Fig. 3 from Ito et al., 2008
hindbrain apoptotic, abnormal WT + MO3-mif Fig. 4 from Ito et al., 2008
hindbrain decreased size, abnormal WT + MO3-mif Fig. 3 from Ito et al., 2008
lens decreased size, abnormal WT + MO3-mif Fig. 3 from Ito et al., 2008
lens epithelium vacuolated, abnormal WT + MO3-mif Fig. 3 from Ito et al., 2008
mandibular arch skeleton malformed, abnormal WT + MO3-mif Fig. 3 from Ito et al., 2008
optic tectum apoptotic, abnormal WT + MO3-mif Fig. 4 from Ito et al., 2008
optic tectum swollen, abnormal WT + MO3-mif Fig. 3,  text only from Ito et al., 2008
pectoral fin malformed, abnormal WT + MO3-mif Fig. 3 from Ito et al., 2008
post-vent region curved ventral, abnormal WT + MO3-mif Fig. 3 from Ito et al., 2008
retina apoptotic, abnormal WT + MO3-mif Fig. 3,  Fig. 4 from Ito et al., 2008
retina shape, abnormal WT + MO3-mif Fig. 3 from Ito et al., 2008
retinal bipolar neuron decreased amount, abnormal WT + MO3-mif Fig. 4 from Ito et al., 2008
retinal ganglion cell decreased amount, abnormal WT + MO3-mif Fig. 4 from Ito et al., 2008
Phenotype of all Fish created by or utilizing MO3-mif
Phenotype Fish Conditions Figures
amacrine cell decreased amount, abnormal WT + MO3-mif standard conditions Fig. 4 from Ito et al., 2008
retinal bipolar neuron decreased amount, abnormal WT + MO3-mif standard conditions Fig. 4 from Ito et al., 2008
mandibular arch skeleton malformed, abnormal WT + MO3-mif standard conditions Fig. 3 from Ito et al., 2008
retina apoptotic, abnormal WT + MO3-mif standard conditions Fig. 3,  Fig. 4 from Ito et al., 2008
hindbrain decreased size, abnormal WT + MO3-mif standard conditions Fig. 3 from Ito et al., 2008
optic tectum swollen, abnormal WT + MO3-mif standard conditions Fig. 3,  text only from Ito et al., 2008
fourth ventricle increased size, abnormal WT + MO3-mif standard conditions Fig. 3 from Ito et al., 2008
head decreased size, abnormal WT + MO3-mif standard conditions Fig. 3 from Ito et al., 2008
hindbrain apoptotic, abnormal WT + MO3-mif standard conditions Fig. 4 from Ito et al., 2008
optic tectum apoptotic, abnormal WT + MO3-mif standard conditions Fig. 4 from Ito et al., 2008
eye malformed, abnormal WT + MO3-mif standard conditions Fig. 3,  text only from Ito et al., 2008
post-vent region curved ventral, abnormal WT + MO3-mif standard conditions Fig. 3 from Ito et al., 2008
retina shape, abnormal WT + MO3-mif standard conditions Fig. 3 from Ito et al., 2008
lens epithelium vacuolated, abnormal WT + MO3-mif standard conditions Fig. 3 from Ito et al., 2008
lens decreased size, abnormal WT + MO3-mif standard conditions Fig. 3 from Ito et al., 2008
eye decreased size, abnormal WT + MO3-mif standard conditions Fig. 3,  text only from Ito et al., 2008
pectoral fin malformed, abnormal WT + MO3-mif standard conditions Fig. 3 from Ito et al., 2008
cell population proliferation disrupted, abnormal WT + MO3-mif standard conditions Fig. 4 from Ito et al., 2008
retinal ganglion cell decreased amount, abnormal WT + MO3-mif standard conditions Fig. 4 from Ito et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.