Morpholino
MO1-mif
- ID
- ZDB-MRPHLNO-080708-4
- Name
- MO1-mif
- Previous Names
- None
- Target
- Sequence
-
5' - TGTGTTCACTACAAACATCGGCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino that targets mif.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mif
No data available
Phenotype
Phenotype resulting from MO1-mif
Phenotype | Fish | Figures |
---|---|---|
eye decreased size, abnormal | WT + MO1-mif |
text only
from Ito et al., 2008 |
eye malformed, abnormal | WT + MO1-mif |
text only
from Ito et al., 2008 |
optic tectum swollen, abnormal | WT + MO1-mif |
text only
from Ito et al., 2008 |
Phenotype of all Fish created by or utilizing MO1-mif
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
eye malformed, abnormal | WT + MO1-mif | standard conditions |
text only
from Ito et al., 2008 |
optic tectum swollen, abnormal | WT + MO1-mif | standard conditions |
text only
from Ito et al., 2008 |
eye decreased size, abnormal | WT + MO1-mif | standard conditions |
text only
from Ito et al., 2008 |
Citations