Morpholino

MO2-stra6

ID
ZDB-MRPHLNO-080521-2
Name
MO2-stra6
Previous Names
None
Target
Sequence
5' - GTTATTCACAGTTTCAGCACTCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-stra6
Expressed Gene Anatomy Figures
cyp26a1 Fig. 5 with image from Isken et al., 2008
egr2b Fig. 5 with image from Isken et al., 2008
myod1 Fig. 5 with image from Isken et al., 2008
pax6a Fig. 5 with image from Isken et al., 2008
Phenotype
Phenotype resulting from MO2-stra6
Phenotype Fish Figures
atrium dilated, abnormal y1Tg + MO2-stra6 Fig. 4 with image from Isken et al., 2008
blood circulation disrupted, abnormal AB/TL + MO2-stra6 Fig. 4 with image from Isken et al., 2008
ceratobranchial cartilage decreased size, abnormal AB/TL + MO2-stra6 Fig. 4 with image from Isken et al., 2008
ceratohyal cartilage deformed, abnormal AB/TL + MO2-stra6 Fig. 4 with image from Isken et al., 2008
eye decreased size, abnormal AB/TL + MO2-stra6 Fig. 3 with image,  Fig. 4 with image from Isken et al., 2008
head hemorrhagic, abnormal AB/TL + MO2-stra6 Fig. 4 with image from Isken et al., 2008
heart malformed, abnormal AB/TL + MO2-stra6 Fig. 4 with image from Isken et al., 2008
heart morphology, abnormal AB/TL + MO2-stra6 Fig. 6 with image from Isken et al., 2008
heart looping disrupted, abnormal y1Tg + MO2-stra6 Fig. 4 with image from Isken et al., 2008
Meckel's cartilage deformed, abnormal AB/TL + MO2-stra6 Fig. 4 with image from Isken et al., 2008
nucleate erythrocyte position, abnormal AB/TL + MO2-stra6 Fig. 4 with image from Isken et al., 2008
palatoquadrate cartilage deformed, abnormal AB/TL + MO2-stra6 Fig. 4 with image from Isken et al., 2008
pericardium edematous, abnormal AB/TL + MO2-stra6 Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Isken et al., 2008
pharyngeal arch 3-7 morphology, abnormal AB/TL + MO2-stra6 Fig. 4 with image from Isken et al., 2008
presumptive neural retina decreased size, abnormal AB/TL + MO2-stra6 Fig. 5 with image from Isken et al., 2008
retinoid metabolic process disrupted, abnormal AB/TL + MO2-stra6 Fig. 3 with image from Isken et al., 2008
whole organism curved ventral, abnormal AB/TL + MO2-stra6 Fig. 3 with image from Isken et al., 2008
whole organism increased curvature, abnormal AB/TL + MO2-stra6 Fig. 3 with image from Isken et al., 2008
Phenotype of all Fish created by or utilizing MO2-stra6
Phenotype Fish Conditions Figures
whole organism increased curvature, abnormal AB/TL + MO2-stra6 standard conditions Fig. 3 with image from Isken et al., 2008
blood circulation disrupted, abnormal AB/TL + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
presumptive neural retina decreased size, abnormal AB/TL + MO2-stra6 standard conditions Fig. 5 with image from Isken et al., 2008
nucleate erythrocyte position, abnormal AB/TL + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
ceratohyal cartilage deformed, abnormal AB/TL + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
pharyngeal arch 3-7 morphology, abnormal AB/TL + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
heart malformed, abnormal AB/TL + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
heart morphology, abnormal AB/TL + MO2-stra6 standard conditions Fig. 6 with image from Isken et al., 2008
whole organism curved ventral, abnormal AB/TL + MO2-stra6 standard conditions Fig. 3 with image from Isken et al., 2008
palatoquadrate cartilage deformed, abnormal AB/TL + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
ceratobranchial cartilage decreased size, abnormal AB/TL + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
Meckel's cartilage deformed, abnormal AB/TL + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
pericardium edematous, abnormal AB/TL + MO2-stra6 standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Isken et al., 2008
head hemorrhagic, abnormal AB/TL + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
retinoid metabolic process disrupted, abnormal AB/TL + MO2-stra6 standard conditions Fig. 3 with image from Isken et al., 2008
eye decreased size, abnormal AB/TL + MO2-stra6 standard conditions Fig. 3 with image,  Fig. 4 with image from Isken et al., 2008
atrium dilated, abnormal y1Tg + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
heart looping disrupted, abnormal y1Tg + MO2-stra6 standard conditions Fig. 4 with image from Isken et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.