Morpholino

MO2-kdrl

ID

ZDB-MRPHLNO-080516-9

Name

MO2-kdrl

Previous Names

MO-kdra (1)
MO2-kdr

Target

kdrl (1)

Sequence

5' - CCGAATGATACTCCGTATGTCACTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-kdrl

No data available

Phenotype

Phenotype resulting from MO2-kdrl

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	y1Tg + MO2-kdrl	Fig. 5 from Bahary et al., 2007
angiogenesis process quality, abnormal	y1Tg + MO2-kdrl	Fig. 5 from Bridge et al., 2012
intersegmental vessel decreased amount, abnormal	y1Tg + MO2-kdrl	FIGURE 5 from Field et al., 2022 Fig. 5 from Bridge et al., 2012
intersegmental vessel decreased size, abnormal	y1Tg + MO2-kdrl	Fig. 5 from Bridge et al., 2012
intersegmental vessel endothelial cell proliferation decreased occurrence, abnormal	y1Tg + MO2-kdrl	FIGURE 6 from Field et al., 2022

Phenotype of all Fish created by or utilizing MO2-kdrl

Phenotype	Fish	Conditions	Figures
intersegmental vessel endothelial cell proliferation decreased occurrence, abnormal	y1Tg + MO2-kdrl	standard conditions	FIGURE 6 from Field et al., 2022
intersegmental vessel decreased size, abnormal	y1Tg + MO2-kdrl	standard conditions	Fig. 5 from Bridge et al., 2012
angiogenesis process quality, abnormal	y1Tg + MO2-kdrl	standard conditions	Fig. 5 from Bridge et al., 2012
angiogenesis disrupted, abnormal	y1Tg + MO2-kdrl	standard conditions	Fig. 5 from Bahary et al., 2007
intersegmental vessel decreased amount, abnormal	y1Tg + MO2-kdrl	standard conditions	FIGURE 5 from Field et al., 2022 Fig. 5 from Bridge et al., 2012
intersegmental vessel decreased amount, exacerbated	y1Tg + MO1-tmem184a + MO2-kdrl	standard conditions	FIGURE 5 from Field et al., 2022
angiogenesis process quality, abnormal	y1Tg + MO2-kdr + MO2-kdrl	standard conditions	Fig. 5 from Bridge et al., 2012
intersegmental vessel malformed, abnormal	y1Tg + MO2-kdr + MO2-kdrl	standard conditions	Fig. 5 from Bahary et al., 2007
intersegmental vessel decreased size, abnormal	y1Tg + MO2-kdr + MO2-kdrl	standard conditions	Fig. 5 from Bridge et al., 2012
intersegmental vessel decreased amount, abnormal	y1Tg + MO2-kdr + MO2-kdrl	standard conditions	Fig. 5 from Bridge et al., 2012
vasculogenesis disrupted, abnormal	y1Tg + MO2-kdr + MO2-kdrl	standard conditions	Fig. 5 from Bahary et al., 2007
intersegmental vessel malformed, abnormal	y1Tg + MO2-kdrl + MO3-kdr	standard conditions	Fig. 5 from Bahary et al., 2007
vasculogenesis disrupted, abnormal	y1Tg + MO2-kdrl + MO3-kdr	standard conditions	Fig. 5 from Bahary et al., 2007
intersegmental vessel sprouting angiogenesis delayed, abnormal	zf531Tg + MO2-ecscr + MO2-kdrl	standard conditions	Fig. 6 from Kilari et al., 2013

Citations