Morpholino

MO2-smad2

ID

ZDB-MRPHLNO-080313-3

Name

MO2-smad2

Previous Names

Target

Sequence

5' - TTACCCTTCCTACGAAAAGCGTTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-smad2

No data available

Phenotype

Phenotype resulting from MO2-smad2

Phenotype	Fish	Figures
floor plate absent, abnormal	ia16Tg + MO2-smad2	Fig. 2 from Casari et al., 2014
intermediate cell mass of mesoderm increased size, abnormal	ia16Tg + MO2-smad2	Fig. 2 from Casari et al., 2014
neuron degenerate, abnormal	WT + MO2-smad2	Fig. 1 from Jia et al., 2008
whole organism ab1-smad2/3 labeling decreased amount, abnormal	TU + MO2-smad2	Fig. 1 from Liu et al., 2011
whole organism decreased length, abnormal	WT + MO2-smad2	Fig. 1 from Jia et al., 2008
whole organism anterior region truncated, abnormal	ia16Tg + MO2-smad2	Fig. 2 from Casari et al., 2014
whole organism anterior-posterior axis curved, abnormal	ia16Tg + MO2-smad2	Fig. 2 from Casari et al., 2014
whole organism anterior-posterior axis shortened, abnormal	ia16Tg + MO2-smad2	Fig. 2 from Casari et al., 2014

Phenotype of all Fish created by or utilizing MO2-smad2

Phenotype	Fish	Conditions	Figures
whole organism ab1-smad2/3 labeling decreased amount, abnormal	TU + MO2-smad2	standard conditions	Fig. 1 from Liu et al., 2011
whole organism decreased length, abnormal	WT + MO2-smad2	standard conditions	Fig. 1 from Jia et al., 2008
neuron degenerate, abnormal	WT + MO2-smad2	standard conditions	Fig. 1 from Jia et al., 2008
intermediate cell mass of mesoderm increased size, abnormal	ia16Tg + MO2-smad2	standard conditions	Fig. 2 from Casari et al., 2014
whole organism anterior region truncated, abnormal	ia16Tg + MO2-smad2	standard conditions	Fig. 2 from Casari et al., 2014
floor plate absent, abnormal	ia16Tg + MO2-smad2	standard conditions	Fig. 2 from Casari et al., 2014
whole organism anterior-posterior axis curved, abnormal	ia16Tg + MO2-smad2	standard conditions	Fig. 2 from Casari et al., 2014
whole organism anterior-posterior axis shortened, abnormal	ia16Tg + MO2-smad2	standard conditions	Fig. 2 from Casari et al., 2014
neuron degenerate, abnormal	WT + MO1-smad3a + MO2-smad2 + MO2-smad3b	standard conditions	Fig. 1 from Jia et al., 2008
whole organism decreased length, abnormal	WT + MO1-smad3a + MO2-smad2 + MO2-smad3b	standard conditions	Fig. 1 from Jia et al., 2008

Citations