Morpholino

MO1-sox11b

ID
ZDB-MRPHLNO-080208-4
Name
MO1-sox11b
Previous Names
None
Target
Sequence
5' - CATGTTCAAACACACTTTTCCCTCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino targets the transcription start site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sox11b
No data available
Phenotype
Phenotype resulting from MO1-sox11b
Phenotype Fish Figures
caudal vein plexus morphology, abnormal s843Tg + MO1-sox11b Fig. 4 from Schmitt et al., 2013
caudal vein plexus angiogenic sprout decreased amount, abnormal s843Tg + MO1-sox11b Fig. 4 from Schmitt et al., 2013
intersegmental vessel decreased length, abnormal s843Tg + MO1-sox11b Fig. 4 from Schmitt et al., 2013
vasculature development disrupted, abnormal s843Tg + MO1-sox11b Fig. 4 from Schmitt et al., 2013
Phenotype of all Fish created by or utilizing MO1-sox11b
Phenotype Fish Conditions Figures
caudal vein plexus angiogenic sprout decreased amount, abnormal s843Tg + MO1-sox11b standard conditions Fig. 4 from Schmitt et al., 2013
caudal vein plexus morphology, abnormal s843Tg + MO1-sox11b standard conditions Fig. 4 from Schmitt et al., 2013
vasculature development disrupted, abnormal s843Tg + MO1-sox11b standard conditions Fig. 4 from Schmitt et al., 2013
intersegmental vessel decreased length, abnormal s843Tg + MO1-sox11b standard conditions Fig. 4 from Schmitt et al., 2013
optic fissure closure incomplete, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 9 with image from Wen et al., 2015
Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Pillai-Kastoori et al., 2014
retina has fewer parts of type retinal rod cell, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 3 with image from Pillai-Kastoori et al., 2014
optic vesicle cell population proliferation increased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. S2 with image from Pillai-Kastoori et al., 2014
retina layer formation decreased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
retina protruding out of brain, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
optic fissure open, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Pillai-Kastoori et al., 2014
retinal pigmented epithelium open, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
eye decreased size, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
retinal rod cell development process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 3 with image from Pillai-Kastoori et al., 2014
lens apoptotic process increased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. S2 with image from Pillai-Kastoori et al., 2014
optic vesicle apoptotic process increased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. S2 with image from Pillai-Kastoori et al., 2014
retina cell population proliferation increased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. S2 with image from Pillai-Kastoori et al., 2014
lens malformed, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 9 with image from Wen et al., 2015
Fig. 2 with image,  Fig. 7 with image from Pillai-Kastoori et al., 2014
caudal fin kinked, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
retina ventral region decreased pigmentation, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image,  Fig. 7 with image from Pillai-Kastoori et al., 2014
retina ventral region immature, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 2 with image from Pillai-Kastoori et al., 2014
closure of optic fissure decreased process quality, abnormal WT + MO1-sox11b + MO2-sox11a standard conditions Fig. 9 with image from Wen et al., 2015
optic fissure closure incomplete, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
closure of optic fissure decreased process quality, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
lens malformed, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.