Morpholino

MO1-ptpn21

ID
ZDB-MRPHLNO-080102-2
Name
MO1-ptpn21
Previous Names
  • PezMO1 (1)
Target
Sequence
5' - AGCTTTCCTCTGCGCTTAATCCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptpn21
Expressed Gene Anatomy Figures
tgfb3 Fig. 8 from Wyatt et al., 2007
Phenotype
Phenotype resulting from MO1-ptpn21
Phenotype Fish Figures
atrioventricular valve non-functional, abnormal y1Tg + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
blood cell aggregated, abnormal WT + MO1-ptpn21 Fig. S2 from Wyatt et al., 2007
heart decreased size, abnormal y1Tg + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
heart edematous, abnormal WT + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
heart contraction disrupted, abnormal WT + MO1-ptpn21 Fig. S2 from Wyatt et al., 2007
heart looping arrested, abnormal y1Tg + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
melanocyte mislocalised, abnormal WT + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
pharyngeal arch decreased length, abnormal WT + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
pharyngeal arch cell increased mass density, abnormal WT + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
pharyngeal arch cartilage decreased size, abnormal WT + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
somite border irregular spatial pattern, abnormal WT + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
ventricular zone increased size, abnormal WT + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
ventricular zone cell increased mass density, abnormal WT + MO1-ptpn21 Fig. 2 from Wyatt et al., 2007
Phenotype of all Fish created by or utilizing MO1-ptpn21
Phenotype Fish Conditions Figures
heart edematous, abnormal WT + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
ventricular zone cell increased mass density, abnormal WT + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
pharyngeal arch decreased length, abnormal WT + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
melanocyte mislocalised, abnormal WT + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
blood cell aggregated, abnormal WT + MO1-ptpn21 standard conditions Fig. S2 from Wyatt et al., 2007
ventricular zone increased size, abnormal WT + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
heart contraction disrupted, abnormal WT + MO1-ptpn21 standard conditions Fig. S2 from Wyatt et al., 2007
pharyngeal arch cell increased mass density, abnormal WT + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
somite border irregular spatial pattern, abnormal WT + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
pharyngeal arch cartilage decreased size, abnormal WT + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
heart looping arrested, abnormal y1Tg + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
heart decreased size, abnormal y1Tg + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
atrioventricular valve non-functional, abnormal y1Tg + MO1-ptpn21 standard conditions Fig. 2 from Wyatt et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.