Morpholino

MO2-shox2

ID

ZDB-MRPHLNO-071220-4

Name

MO2-shox2

Previous Names

None

Target

Sequence

5' - ACGCTGTAAGTTCTTCCATCACTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-shox2

Expressed Gene	Anatomy	Figures
isl1a	brain whole organism	Fig. S5, Fig. S6 from Hoffmann et al., 2013
shox2	brain	Fig. S6 from Hoffmann et al., 2013

Phenotype

Phenotype resulting from MO2-shox2

Phenotype	Fish	Figures
blood accumulation pericardium, abnormal	WT + MO2-shox2	Fig. 5 from Hoffmann et al., 2016 Fig. 4 from Hoffmann et al., 2013
blood circulation disrupted, abnormal	WT + MO2-shox2	Fig. 5 from Hoffmann et al., 2016
heart decreased functionality, abnormal	WT + MO2-shox2	Fig. 4 from Hoffmann et al., 2013 text only from Blaschke et al., 2007
heart contraction decreased occurrence, abnormal	WT + MO2-shox2	Fig. 4 from Hoffmann et al., 2013
heart contraction decreased rate, abnormal	WT + MO2-shox2	Fig. 5 from Hoffmann et al., 2016 text only from Blaschke et al., 2007
pericardium edematous, abnormal	WT + MO2-shox2	Fig. 5 from Hoffmann et al., 2016 Fig. 4 from Hoffmann et al., 2013
regulation of heart contraction disrupted, abnormal	WT + MO2-shox2	Fig. 4 from Hoffmann et al., 2013
sinus venosus hypoplastic, abnormal	WT + MO2-shox2	text only from Blaschke et al., 2007
sinus venosus myocardium poorly differentiated, abnormal	WT + MO2-shox2	text only from Blaschke et al., 2007

Phenotype of all Fish created by or utilizing MO2-shox2

Phenotype	Fish	Conditions	Figures
regulation of heart contraction disrupted, abnormal	WT + MO2-shox2	standard conditions	Fig. 4 from Hoffmann et al., 2013
heart contraction decreased rate, abnormal	WT + MO2-shox2	standard conditions	Fig. 5 from Hoffmann et al., 2016 text only from Blaschke et al., 2007
blood circulation disrupted, abnormal	WT + MO2-shox2	standard conditions	Fig. 5 from Hoffmann et al., 2016
sinus venosus myocardium poorly differentiated, abnormal	WT + MO2-shox2	standard conditions	text only from Blaschke et al., 2007
heart contraction decreased occurrence, abnormal	WT + MO2-shox2	standard conditions	Fig. 4 from Hoffmann et al., 2013
pericardium edematous, abnormal	WT + MO2-shox2	standard conditions	Fig. 5 from Hoffmann et al., 2016 Fig. 4 from Hoffmann et al., 2013
heart decreased functionality, abnormal	WT + MO2-shox2	standard conditions	Fig. 4 from Hoffmann et al., 2013 text only from Blaschke et al., 2007
sinus venosus hypoplastic, abnormal	WT + MO2-shox2	standard conditions	text only from Blaschke et al., 2007
blood accumulation pericardium, abnormal	WT + MO2-shox2	standard conditions	Fig. 5 from Hoffmann et al., 2016 Fig. 4 from Hoffmann et al., 2013

Citations