Morpholino

MO1-loxl3b

ID
ZDB-MRPHLNO-070919-3
Name
MO1-loxl3b
Previous Names
  • MO2 loxl3b (1)
Target
Sequence
5' - CAGCTGCGGACATAAACAAACAAAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-loxl3b
Expressed Gene Anatomy Figures
loxl3b Fig. S3 with image from Gansner et al., 2007
Phenotype
Phenotype resulting from MO1-loxl3b
Phenotype Fish Figures
cartilage condensation decreased occurrence, abnormal WT + MO1-loxl3b + MO4-tp53 Fig. 6 from van Boxtel et al., 2011
ceratobranchial cartilage absent, abnormal WT + MO1-loxl3b Fig. 2 from van Boxtel et al., 2011
ceratobranchial cartilage malformed, abnormal WT + MO1-loxl3b Fig. 2 from van Boxtel et al., 2011
ceratobranchial cartilage chondrocyte decreased size, abnormal WT + MO1-loxl3b Fig. 5 from van Boxtel et al., 2011
ceratobranchial cartilage chondrocyte immature, abnormal WT + MO1-loxl3b Fig. 5 from van Boxtel et al., 2011
ceratobranchial cartilage supramolecular fiber increased amount, abnormal WT + MO1-loxl3b Fig. 5 from van Boxtel et al., 2011
ceratobranchial cartilage supramolecular fiber increased thickness, abnormal WT + MO1-loxl3b Fig. 5 from van Boxtel et al., 2011
ceratohyal cartilage malformed, abnormal WT + MO1-loxl3b Fig. 2 from van Boxtel et al., 2011
chondrocyte differentiation decreased occurrence, abnormal WT + MO1-loxl3b + MO4-tp53 Fig. 6 from van Boxtel et al., 2011
chondrocyte proliferation decreased occurrence, abnormal vu234Tg + MO1-loxl3b Fig. 7 from van Boxtel et al., 2011
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO1-loxl3b Fig. 2,  Fig. 3,  Fig. 5,  Fig. 6 from van Boxtel et al., 2011
ethmoid cartilage decreased size, abnormal WT + MO1-loxl3b Fig. 2 from van Boxtel et al., 2011
Meckel's cartilage malformed, abnormal WT + MO1-loxl3b Fig. 2 from van Boxtel et al., 2011
neurocranial trabecula decreased size, abnormal WT + MO1-loxl3b Fig. 2 from van Boxtel et al., 2011
notochord kinked, abnormal WT + MO1-loxl3b Fig. 5 with image from Gansner et al., 2007
pharyngeal arch cartilage immature, abnormal WT + MO1-loxl3b Fig. 4 from van Boxtel et al., 2011
pharyngeal arch cartilage malformed, abnormal WT + MO1-loxl3b Fig. 2,  Fig. 3 from van Boxtel et al., 2011
supramolecular fiber organization decreased process quality, abnormal WT + MO1-loxl3b Fig. 5 from van Boxtel et al., 2011
Phenotype of all Fish created by or utilizing MO1-loxl3b
Phenotype Fish Conditions Figures
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO1-loxl3b standard conditions Fig. 2,  Fig. 3,  Fig. 5 from van Boxtel et al., 2011
pharyngeal arch cartilage malformed, abnormal WT + MO1-loxl3b standard conditions Fig. 2,  Fig. 3 from van Boxtel et al., 2011
ethmoid cartilage decreased size, abnormal WT + MO1-loxl3b standard conditions Fig. 2 from van Boxtel et al., 2011
neurocranial trabecula decreased size, abnormal WT + MO1-loxl3b standard conditions Fig. 2 from van Boxtel et al., 2011
ceratobranchial cartilage chondrocyte immature, abnormal WT + MO1-loxl3b standard conditions Fig. 5 from van Boxtel et al., 2011
ceratobranchial cartilage supramolecular fiber increased amount, abnormal WT + MO1-loxl3b standard conditions Fig. 5 from van Boxtel et al., 2011
ceratohyal cartilage malformed, abnormal WT + MO1-loxl3b standard conditions Fig. 2 from van Boxtel et al., 2011
supramolecular fiber organization decreased process quality, abnormal WT + MO1-loxl3b standard conditions Fig. 5 from van Boxtel et al., 2011
ceratobranchial cartilage absent, abnormal WT + MO1-loxl3b standard conditions Fig. 2 from van Boxtel et al., 2011
notochord kinked, abnormal WT + MO1-loxl3b standard conditions Fig. 5 with image from Gansner et al., 2007
ceratobranchial cartilage supramolecular fiber increased thickness, abnormal WT + MO1-loxl3b standard conditions Fig. 5 from van Boxtel et al., 2011
Meckel's cartilage malformed, abnormal WT + MO1-loxl3b standard conditions Fig. 2 from van Boxtel et al., 2011
ceratobranchial cartilage malformed, abnormal WT + MO1-loxl3b standard conditions Fig. 2 from van Boxtel et al., 2011
ceratobranchial cartilage chondrocyte decreased size, abnormal WT + MO1-loxl3b standard conditions Fig. 5 from van Boxtel et al., 2011
pharyngeal arch cartilage immature, abnormal WT + MO1-loxl3b standard conditions Fig. 4 from van Boxtel et al., 2011
chondrocyte differentiation decreased occurrence, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 6 from van Boxtel et al., 2011
pharyngeal arch cartilage malformed, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 3 from van Boxtel et al., 2011
cartilage condensation decreased occurrence, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 6 from van Boxtel et al., 2011
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO1-loxl3b + MO4-tp53 standard conditions Fig. 3,  Fig. 6 from van Boxtel et al., 2011
chondrocyte proliferation decreased occurrence, abnormal vu234Tg + MO1-loxl3b standard conditions Fig. 7 from van Boxtel et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.