Morpholino

MO2-ponzr1

ID
ZDB-MRPHLNO-070727-4
Name
MO2-ponzr1
Previous Names
  • SP2054 MO2 (1)
Target
Sequence
5' - CCGTAGTAGAAATTGCTGCCATGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ponzr1
No data available
Phenotype
Phenotype resulting from MO2-ponzr1
Phenotype Fish Figures
cranium morphology, abnormal WT + MO2-ponzr1 text only from Pickart et al., 2006
head decreased size, abnormal WT + MO2-ponzr1 Fig. 6 with image from Robu et al., 2007
nervous system apoptotic, abnormal WT + MO2-ponzr1 Fig. 6 with image from Robu et al., 2007
pharyngeal arch aplastic, abnormal WT + MO2-ponzr1 Fig. 7 with image from Bedell et al., 2012
pronephric glomerulus aplastic, abnormal li1Tg + MO2-ponzr1 Fig. 5 with image from Bedell et al., 2012
pronephric podocyte fused with pronephric podocyte, abnormal WT + MO2-ponzr1 Fig. 4 with image from Bedell et al., 2012
pronephric tubule dilated, abnormal WT + MO2-ponzr1 Fig. 5 with image from Bedell et al., 2012
pronephric tubule anterior region fused with pronephric tubule anterior region, abnormal WT + MO2-ponzr1 Fig. 4 with image from Bedell et al., 2012
pronephric tubule anterior region malformed, abnormal li1Tg + MO2-ponzr1 Fig. 5 with image from Bedell et al., 2012
pronephros anterior region deformed, abnormal WT + MO2-ponzr1 Fig. 4 with image from Bedell et al., 2012
Phenotype of all Fish created by or utilizing MO2-ponzr1
Phenotype Fish Conditions Figures
cranium morphology, abnormal WT + MO2-ponzr1 standard conditions text only from Pickart et al., 2006
pharyngeal arch aplastic, abnormal WT + MO2-ponzr1 standard conditions Fig. 7 with image from Bedell et al., 2012
pronephric tubule dilated, abnormal WT + MO2-ponzr1 standard conditions Fig. 5 with image from Bedell et al., 2012
head decreased size, abnormal WT + MO2-ponzr1 standard conditions Fig. 6 with image from Robu et al., 2007
nervous system apoptotic, abnormal WT + MO2-ponzr1 standard conditions Fig. 6 with image from Robu et al., 2007
pronephric tubule anterior region fused with pronephric tubule anterior region, abnormal WT + MO2-ponzr1 standard conditions Fig. 4 with image from Bedell et al., 2012
pronephric glomerulus aplastic, abnormal WT + MO2-ponzr1 standard conditions Fig. 5 with image from Bedell et al., 2012
pronephros anterior region deformed, abnormal WT + MO2-ponzr1 standard conditions Fig. 4 with image from Bedell et al., 2012
pronephric podocyte fused with pronephric podocyte, abnormal WT + MO2-ponzr1 standard conditions Fig. 4 with image from Bedell et al., 2012
pronephric tubule anterior region malformed, abnormal li1Tg + MO2-ponzr1 standard conditions Fig. 5 with image from Bedell et al., 2012
pronephric glomerulus aplastic, abnormal li1Tg + MO2-ponzr1 standard conditions Fig. 5 with image from Bedell et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.