Morpholino

MO2-ttn.2

ID

ZDB-MRPHLNO-070618-2

Name

MO2-ttn.2

Previous Names

Target

Sequence

5' - GTGGAAGACCGGTAAGATTACATCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targets exon 79

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ttn.2

No data available

Phenotype

Phenotype resulting from MO2-ttn.2

Phenotype	Fish	Figures
cardiac muscle cell decreased contractility, abnormal	WT + MO2-ttn.2	Fig. 4 from Seeley et al., 2007
cardiac muscle cell A band disorganized, abnormal	WT + MO2-ttn.2	Fig. 5 from Seeley et al., 2007
cardiac muscle cell Z disc disorganized, abnormal	WT + MO2-ttn.2	Fig. 5 from Seeley et al., 2007
cardiac myofibril assembly disrupted, abnormal	WT + MO2-ttn.2	Fig. 5 from Seeley et al., 2007
heart decreased contractility, abnormal	WT + MO2-ttn.2	Fig. 4 from Seeley et al., 2007
heart edematous, abnormal	WT + MO2-ttn.2	Fig. 4 from Seeley et al., 2007
heart contraction amplitude, abnormal	WT + MO2-ttn.2	Fig. 4 from Seeley et al., 2007
larval locomotory behavior disrupted, abnormal	WT + MO2-ttn.2	text only from Seeley et al., 2007
skeletal muscle cell A band disorganized, abnormal	WT + MO2-ttn.2	Fig. 6 from Seeley et al., 2007
skeletal muscle cell Z disc disorganized, abnormal	WT + MO2-ttn.2	Fig. 6 from Seeley et al., 2007
skeletal myofibril assembly disrupted, abnormal	WT + MO2-ttn.2	Fig. 6 from Seeley et al., 2007
whole organism decreased behavioural activity, abnormal	WT + MO2-ttn.2	text only from Seeley et al., 2007

Phenotype of all Fish created by or utilizing MO2-ttn.2

Phenotype	Fish	Conditions	Figures
cardiac myofibril assembly disrupted, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 5 from Seeley et al., 2007
cardiac muscle cell decreased contractility, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 4 from Seeley et al., 2007
skeletal muscle cell A band disorganized, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 6 from Seeley et al., 2007
heart edematous, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 4 from Seeley et al., 2007
skeletal myofibril assembly disrupted, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 6 from Seeley et al., 2007
skeletal muscle cell Z disc disorganized, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 6 from Seeley et al., 2007
heart contraction amplitude, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 4 from Seeley et al., 2007
cardiac muscle cell Z disc disorganized, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 5 from Seeley et al., 2007
heart decreased contractility, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 4 from Seeley et al., 2007
cardiac muscle cell A band disorganized, abnormal	WT + MO2-ttn.2	standard conditions	Fig. 5 from Seeley et al., 2007
larval locomotory behavior disrupted, abnormal	WT + MO2-ttn.2	standard conditions	text only from Seeley et al., 2007
whole organism decreased behavioural activity, abnormal	WT + MO2-ttn.2	standard conditions	text only from Seeley et al., 2007

Citations