Morpholino

MO1-plxna3

ID
ZDB-MRPHLNO-070613-2
Name
MO1-plxna3
Previous Names
None
Target
Sequence
5' - ATACCAGCAGCCACAAGGACCTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-plxna3
No data available
Phenotype
Phenotype resulting from MO1-plxna3
Phenotype Fish Figures
axon extension delayed, abnormal WT + MO1-plxna3 Fig. 5 with image from Hilario et al., 2009
branching morphogenesis of a nerve increased occurrence, abnormal WT + MO1-plxna3 Fig. 2 from Feldner et al., 2007
branching morphogenesis of a nerve sporadic, abnormal WT + MO1-plxna3 Fig. 2 from Feldner et al., 2007
CaP motoneuron axon decreased length, abnormal WT + MO1-plxna3 Fig. 5 with image from Hilario et al., 2009
motor neuron axon increased amount, abnormal WT + MO1-plxna3 Fig. 2 from Feldner et al., 2007
motor neuron axon structure, abnormal WT + MO1-plxna3 Fig. 2 from Feldner et al., 2007
motor neuron axon guidance disrupted, abnormal WT + MO1-plxna3 Fig. 5 with image from Hilario et al., 2009
motor neuron axon guidance process quality, abnormal WT + MO1-plxna3 Fig. 7 with image from Plazas et al., 2013
myotome CaP motoneuron hypoplastic, abnormal WT + MO1-plxna3 Fig. 5 with image from Hilario et al., 2009
Phenotype of all Fish created by or utilizing MO1-plxna3
Phenotype Fish Conditions Figures
regenerating fin decreased length, abnormal C32 + MO1-plxna3 amputation Fig. 3 with image from Ton et al., 2012
motor neuron axon guidance disrupted, abnormal WT + MO1-plxna3 standard conditions Fig. 5 with image from Hilario et al., 2009
motor neuron axon guidance process quality, abnormal WT + MO1-plxna3 standard conditions Fig. 7 with image from Plazas et al., 2013
motor neuron axon increased amount, abnormal WT + MO1-plxna3 standard conditions Fig. 2 from Feldner et al., 2007
axon extension delayed, abnormal WT + MO1-plxna3 standard conditions Fig. 5 with image from Hilario et al., 2009
motor neuron axon structure, abnormal WT + MO1-plxna3 standard conditions Fig. 2 from Feldner et al., 2007
myotome CaP motoneuron hypoplastic, abnormal WT + MO1-plxna3 standard conditions Fig. 5 with image from Hilario et al., 2009
branching morphogenesis of a nerve increased occurrence, abnormal WT + MO1-plxna3 standard conditions Fig. 2 from Feldner et al., 2007
CaP motoneuron axon decreased length, abnormal WT + MO1-plxna3 standard conditions Fig. 5 with image from Hilario et al., 2009
branching morphogenesis of a nerve sporadic, abnormal WT + MO1-plxna3 standard conditions Fig. 2 from Feldner et al., 2007
regenerating fin lepidotrichium segment decreased length, abnormal kcnk5bty86d/ty86d + MO1-plxna3 amputation Fig. 2 with image from Ton et al., 2012
CaP motoneuron axon decreased length, abnormal WT + MO1-plxna3 + MO1-sema5a standard conditions Fig. 5 with image from Hilario et al., 2009
motor neuron axon guidance disrupted, abnormal WT + MO1-plxna3 + MO1-sema5a standard conditions Fig. 5 with image from Hilario et al., 2009
myotome CaP motoneuron hypoplastic, abnormal WT + MO1-plxna3 + MO1-sema5a standard conditions Fig. 5 with image from Hilario et al., 2009
axon extension delayed, abnormal WT + MO1-plxna3 + MO1-sema5a standard conditions Fig. 5 with image from Hilario et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.