Morpholino

MO1-rap1aa

ID

ZDB-MRPHLNO-070519-1

Name

MO1-rap1aa

Previous Names

MO1-rap1a

Target

rap1aa (1)

Sequence

5' - TGGTGGCAGATTATTTCTTTTCACC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rap1aa

No data available

Phenotype

Phenotype resulting from MO1-rap1aa

Phenotype	Fish	Figures
whole organism decreased length, abnormal	WT + MO1-rap1aa	text only from Tsai et al., 2007
whole organism increased curvature, abnormal	WT + MO1-rap1aa	text only from Tsai et al., 2007

Phenotype of all Fish created by or utilizing MO1-rap1aa

Phenotype	Fish	Conditions	Figures
whole organism increased curvature, abnormal	WT + MO1-rap1aa	standard conditions	text only from Tsai et al., 2007
whole organism decreased length, abnormal	WT + MO1-rap1aa	standard conditions	text only from Tsai et al., 2007
cardiac muscle adherens junction decreased amount, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
trunk increased curvature, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
cardiac muscle gap junction decreased amount, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
pericardium edematous, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
caudal fin blistered, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
cardiac conduction disrupted, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 4 from Dong et al., 2012
cardiac muscle cardiac myofibril morphology, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
cardiac muscle sarcomere morphology, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
cardiac muscle striated muscle thin filament decreased amount, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
ceratohyal cartilage increased width, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 6 from Bögershausen et al., 2015
eye decreased size, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 2 from Bögershausen et al., 2015
chondrocyte myosin II filament position, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. S4 from Bögershausen et al., 2015
convergent extension involved in gastrulation disrupted, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 2 from Bögershausen et al., 2015
ceratohyal cartilage chondrocyte disorganized, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. S4 from Bögershausen et al., 2015
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage kinked, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 6 from Bögershausen et al., 2015
chondrocyte filamentous actin position, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. S4 from Bögershausen et al., 2015
ceratohyal cartilage shortened, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 6 from Bögershausen et al., 2015
head decreased size, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 2 from Bögershausen et al., 2015
whole organism decreased length, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 2 from Bögershausen et al., 2015
MAP kinase kinase activity process quality, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 10 from Bögershausen et al., 2015
somite increased width, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 2 from Bögershausen et al., 2015
convergent extension disrupted, abnormal	WT + MO1-rap1aa + MO1-rap1b	standard conditions	Fig. 10 from Bögershausen et al., 2015
convergent extension disrupted, abnormal	WT + MO1-rap1aa + MO1-rap1b + MO5-kmt2d	standard conditions	Fig. 7 from Bögershausen et al., 2015
heart looping disrupted, abnormal	pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
pericardium edematous, abnormal	pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
heart malformed, abnormal	pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
heart development disrupted, abnormal	pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 , Fig. 2 from Dong et al., 2012
heart looping disrupted, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. S2 from Dong et al., 2012
cardiac ventricle decreased size, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	text only from Dong et al., 2012
heart development disrupted, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 2 from Dong et al., 2012
heart dilated, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	text only from Dong et al., 2012
heart morphology, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. S2 from Dong et al., 2012
pericardium edematous, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	text only from Dong et al., 2012

Citations