Morpholino

MO1-rpl6

ID

ZDB-MRPHLNO-070327-6

Name

MO1-rpl6

Previous Names

None

Target

rpl6 (1)

Sequence

5' - CTTCTTCTTATCGCCCTCAGCCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rpl6

No data available

Phenotype

Phenotype resulting from MO1-rpl6

Phenotype	Fish	Figures
ball increased size, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
cerebellum decreased thickness, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
extension decreased length, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
fin aplastic, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
forebrain increased size, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
fourth ventricle increased size, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
fourth ventricle opaque, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
hindbrain undulate, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
notochord undulate, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
optic tectum increased size, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006
trunk bent, abnormal	AB + MO1-rpl6	Fig. 3 from Uechi et al., 2006

Phenotype of all Fish created by or utilizing MO1-rpl6

Phenotype	Fish	Conditions	Figures
retina decreased size, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
hindbrain undulate, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
optic tectum increased size, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
trunk bent, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
extension decreased length, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
fourth ventricle opaque, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
forebrain increased size, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
notochord undulate, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
ball increased size, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
cerebellum decreased thickness, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
fin aplastic, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006
fourth ventricle increased size, abnormal	AB + MO1-rpl6	standard conditions	Fig. 3 from Uechi et al., 2006

Citations