Morpholino

MO1-rps29

ID
ZDB-MRPHLNO-070327-3
Name
MO1-rps29
Previous Names
None
Target
Sequence
5' - TCCAGTAGAGCTGCTGATGGCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rps29
No data available
Phenotype
Phenotype resulting from MO1-rps29
Phenotype Fish Figures
ball deformed, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
ball increased size, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
cerebellum aplastic, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
extension decreased length, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
extension decreased thickness, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
extension deformed, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
fin aplastic, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
forebrain morphology, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
fourth ventricle increased size, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
fourth ventricle opaque, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal AB + MO1-rps29 Fig. 2 with image,  Fig. 3 with image from Uechi et al., 2006
lens increased size, abnormal AB + MO1-rps29 Fig. 2 with image,  Fig. 3 with image from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
notochord bent, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
otic placode aplastic, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rps29 Fig. 3 with image from Uechi et al., 2006
Phenotype of all Fish created by or utilizing MO1-rps29
Phenotype Fish Conditions Figures
lens increased size, abnormal AB + MO1-rps29 standard conditions Fig. 2 with image,  Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
ball deformed, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
extension decreased length, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
extension deformed, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain morphology, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
ball increased size, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
fin aplastic, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
fourth ventricle increased size, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
cerebellum aplastic, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal AB + MO1-rps29 standard conditions Fig. 2 with image,  Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
notochord bent, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
otic placode aplastic, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
fourth ventricle opaque, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
extension decreased thickness, abnormal AB + MO1-rps29 standard conditions Fig. 3 with image from Uechi et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.