Morpholino

MO1-rplp2l

ID

ZDB-MRPHLNO-070327-16

Name

MO1-rplp2l

Previous Names

None

Target

rplp2l (1)

Sequence

5' - GTAACGCATCTTTGCGGAGAGAAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rplp2l

No data available

Phenotype

Phenotype resulting from MO1-rplp2l

Phenotype	Fish	Figures
ball increased size, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
ball opaque, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
cerebellum decreased thickness, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
extension decreased length, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
extension decreased thickness, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
fin aplastic, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
forebrain protruding, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
fourth ventricle increased size, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
notochord bent, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal	WT + MO1-rplp2l	Fig. 5 from Uechi et al., 2008
otic placode decreased size, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
otolith organ decreased size, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
tegmentum opaque, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006
telencephalon hypoplastic, abnormal	AB + MO1-rplp2l	Fig. 3 from Uechi et al., 2006

Phenotype of all Fish created by or utilizing MO1-rplp2l

Phenotype	Fish	Conditions	Figures
tegmentum opaque, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
extension decreased length, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
fourth ventricle increased size, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
cerebellum decreased thickness, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
fin aplastic, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
extension decreased thickness, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
notochord bent, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
ball opaque, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
telencephalon hypoplastic, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
forebrain protruding, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
otolith organ decreased size, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
ball increased size, abnormal	AB + MO1-rplp2l	standard conditions	Fig. 3 from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal	WT + MO1-rplp2l	standard conditions	Fig. 5 from Uechi et al., 2008

Citations