Morpholino

MO1-rpl38

ID

ZDB-MRPHLNO-070327-13

Name

MO1-rpl38

Previous Names

None

Target

rpl38 (1)

Sequence

5' - TTCTTCGATTTTACGTGGCATTGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rpl38

No data available

Phenotype

Phenotype resulting from MO1-rpl38

Phenotype	Fish	Figures
cerebellum decreased thickness, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
extension decreased length, abnormal	AB + MO1-rpl38	Fig. 3 , Fig. S1 from Uechi et al., 2006
extension decreased thickness, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
fin deformed, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
forebrain protruding, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
fourth ventricle increased size, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
fourth ventricle opaque, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
head decreased size, abnormal	AB + MO1-rpl38	Fig. S1 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
otic placode aplastic, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
tegmentum opaque, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
telencephalon deformed, abnormal	AB + MO1-rpl38	Fig. 3 from Uechi et al., 2006
trunk decreased length, abnormal	AB + MO1-rpl38	Fig. S1 from Uechi et al., 2006

Phenotype of all Fish created by or utilizing MO1-rpl38

Phenotype	Fish	Conditions	Figures
fourth ventricle increased size, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
trunk decreased length, abnormal	AB + MO1-rpl38	standard conditions	Fig. S1 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
otic placode aplastic, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
cerebellum decreased thickness, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
head decreased size, abnormal	AB + MO1-rpl38	standard conditions	Fig. S1 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
extension decreased length, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 , Fig. S1 from Uechi et al., 2006
tegmentum opaque, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
extension decreased thickness, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
telencephalon deformed, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
fin deformed, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
forebrain protruding, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006
fourth ventricle opaque, abnormal	AB + MO1-rpl38	standard conditions	Fig. 3 from Uechi et al., 2006

Citations