Morpholino

MO1-rpl35

ID
ZDB-MRPHLNO-070327-10
Name
MO1-rpl35
Previous Names
None
Target
Sequence
5' - GGTCTCTGGCCTTGATCTTTGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rpl35
No data available
Phenotype
Phenotype resulting from MO1-rpl35
Phenotype Fish Figures
ball increased size, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
ball opaque, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
brain aplastic, abnormal AB + MO1-rpl35 Fig. 1 from Yadav et al., 2014
extension decreased length, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
extension decreased thickness, abnormal AB + MO1-rpl35 Fig. 1 from Yadav et al., 2014
Fig. 3 with image from Uechi et al., 2006
eye decreased size, abnormal AB + MO1-rpl35 Fig. 1 from Yadav et al., 2014
fin aplastic, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
fourth ventricle increased size, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl35 + MO4-tp53 Fig. 2 from Yadav et al., 2014
Fig. 5 from Uechi et al., 2008
optic tectum increased size, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
otic placode aplastic, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
otolith organ deformed, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rpl35 Fig. 1 from Yadav et al., 2014
post-vent region deformed, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rpl35 Fig. 3 with image from Uechi et al., 2006
whole organism decreased length, abnormal AB + MO1-rpl35 Fig. 1 from Yadav et al., 2014
Phenotype of all Fish created by or utilizing MO1-rpl35
Phenotype Fish Conditions Figures
extension decreased length, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
ball increased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
extension decreased thickness, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
Fig. 3 with image from Uechi et al., 2006
otolith organ deformed, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
optic tectum opaque, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
otic placode aplastic, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism decreased length, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
fourth ventricle increased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
brain aplastic, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
eye decreased size, abnormal AB + MO1-rpl35 standard conditions Fig. 1 from Yadav et al., 2014
otic placode decreased size, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
fin aplastic, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
post-vent region deformed, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
ball opaque, abnormal AB + MO1-rpl35 standard conditions Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl35 standard conditions Fig. 5 from Uechi et al., 2008
nucleate erythrocyte decreased amount, abnormal WT + MO1-rpl35 + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal tp53zdf1/zdf1 + MO1-rpl35 standard conditions Fig. 2 from Yadav et al., 2014
Citations