Morpholino

MO1-rps8a

ID

ZDB-MRPHLNO-070326-4

Name

MO1-rps8a

Previous Names

MO1-rps8

Target

rps8a (1)

Sequence

5' - TATCCCTTGAGATACCCATTCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rps8a

No data available

Phenotype

Phenotype resulting from MO1-rps8a

Phenotype	Fish	Figures
ball increased size, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
cerebellum aplastic, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
extension decreased thickness, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
fin aplastic, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
forebrain protruding, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
fourth ventricle increased size, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
fourth ventricle opaque, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
notochord bent, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
optic tectum increased size, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
tegmentum opaque, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006
telencephalon morphology, abnormal	AB + MO1-rps8a	Fig. 3 from Uechi et al., 2006

Phenotype of all Fish created by or utilizing MO1-rps8a

Phenotype	Fish	Conditions	Figures
fourth ventricle opaque, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
notochord bent, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
telencephalon morphology, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
extension decreased thickness, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
fourth ventricle increased size, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
fin aplastic, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
tegmentum opaque, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
forebrain protruding, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
ball increased size, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
optic tectum increased size, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
cerebellum aplastic, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rps8a	standard conditions	Fig. 3 from Uechi et al., 2006

Citations