Morpholino

MO1-rps4x

ID

ZDB-MRPHLNO-070326-3

Name

MO1-rps4x

Previous Names

None

Target

rps4x (1)

Sequence

5' - TGCTTCTTCGGTCCTCGGGCCATGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rps4x

No data available

Phenotype

Phenotype resulting from MO1-rps4x

Phenotype	Fish	Figures
ball increased size, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
cerebellum aplastic, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
extension decreased thickness, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
fin aplastic, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
forebrain protruding, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
head flat, abnormal	AB + MO1-rps4x	Fig. 4 from Uechi et al., 2006
hindbrain opaque, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
hindbrain undulate, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
midbrain aplastic, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
optic tectum increased size, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
telencephalon decreased size, abnormal	AB + MO1-rps4x	Fig. 4 from Uechi et al., 2006
telencephalon hypoplastic, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006
trunk undulate, abnormal	AB + MO1-rps4x	Fig. 3 from Uechi et al., 2006

Phenotype of all Fish created by or utilizing MO1-rps4x

Phenotype	Fish	Conditions	Figures
forebrain protruding, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
hindbrain undulate, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
optic tectum increased size, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
extension decreased thickness, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
telencephalon hypoplastic, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
hindbrain opaque, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
midbrain aplastic, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
head flat, abnormal	AB + MO1-rps4x	standard conditions	Fig. 4 from Uechi et al., 2006
cerebellum aplastic, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
telencephalon decreased size, abnormal	AB + MO1-rps4x	standard conditions	Fig. 4 from Uechi et al., 2006
trunk undulate, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
fin aplastic, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006
ball increased size, abnormal	AB + MO1-rps4x	standard conditions	Fig. 3 from Uechi et al., 2006

Citations