Morpholino

MO1-rps3

ID
ZDB-MRPHLNO-070326-1
Name
MO1-rps3
Previous Names
None
Target
Sequence
5' - CTTCTTCGAGATTTGCACCGCCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rps3
No data available
Phenotype
Phenotype resulting from MO1-rps3
Phenotype Fish Figures
ball deformed, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
ball opaque, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
brain aplastic, abnormal AB + MO1-rps3 Fig. 1 from Yadav et al., 2014
cerebellum aplastic, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
extension decreased thickness, abnormal AB + MO1-rps3 Fig. 1 from Yadav et al., 2014
Fig. 3 with image from Uechi et al., 2006
extension deformed, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
eye decreased size, abnormal AB + MO1-rps3 Fig. 1 from Yadav et al., 2014
fin aplastic, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
fin decreased thickness, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
fourth ventricle decreased size, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
lens decreased size, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
midbrain aplastic, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps3 + MO4-tp53 Fig. 2 from Yadav et al., 2014
optic tectum increased size, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rps3 Fig. 1 from Yadav et al., 2014
Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
telencephalon hypoplastic, abnormal AB + MO1-rps3 Fig. 3 with image from Uechi et al., 2006
whole organism decreased length, abnormal AB + MO1-rps3 Fig. 1 from Yadav et al., 2014
Phenotype of all Fish created by or utilizing MO1-rps3
Phenotype Fish Conditions Figures
lens decreased size, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
fin aplastic, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
fourth ventricle decreased size, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
cerebellum aplastic, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
midbrain aplastic, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
fin decreased thickness, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
extension deformed, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism decreased length, abnormal AB + MO1-rps3 standard conditions Fig. 1 from Yadav et al., 2014
post-vent region bent, abnormal AB + MO1-rps3 standard conditions Fig. 1 from Yadav et al., 2014
Fig. 3 with image from Uechi et al., 2006
ball opaque, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
brain aplastic, abnormal AB + MO1-rps3 standard conditions Fig. 1 from Yadav et al., 2014
extension decreased thickness, abnormal AB + MO1-rps3 standard conditions Fig. 1 from Yadav et al., 2014
Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
telencephalon hypoplastic, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
ball deformed, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rps3 standard conditions Fig. 3 with image from Uechi et al., 2006
eye decreased size, abnormal AB + MO1-rps3 standard conditions Fig. 1 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps3 + MO4-tp53 standard conditions Fig. 2 from Yadav et al., 2014
nucleate erythrocyte decreased amount, abnormal tp53zdf1/zdf1 + MO1-rps3 standard conditions Fig. 2 from Yadav et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.