Morpholino

MO1-lratb.1

ID

ZDB-MRPHLNO-070313-1

Name

MO1-lratb.1

Previous Names

Target

Sequence

5' - ACAGCAAGGAGAGAGAATCTAACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lratb.1

Expressed Gene	Anatomy	Figures
cyp26a1	tail bud	Fig. 7 from Isken et al., 2007
egr2b	rhombomere 3 rhombomere 5	Fig. 7 from Isken et al., 2007
fgf8a	head midbrain hindbrain boundary somite tail bud	Fig. 7 from Isken et al., 2007
myod1	segmental plate somite	Fig. 7 from Isken et al., 2007
otx2b	midbrain	Fig. 7 from Isken et al., 2007
pax2a	midbrain hindbrain boundary optic stalk otic vesicle	Fig. 7 from Isken et al., 2007
pax6b	presumptive neural retina	Fig. 7 from Isken et al., 2007
shha	notochord	Fig. 7 from Isken et al., 2007

Phenotype

Phenotype resulting from MO1-lratb.1

Phenotype	Fish	Figures
eye malformed, abnormal	AB/TL + MO1-lratb.1	Fig. 6 from Isken et al., 2007
hindbrain malformed, abnormal	AB/TL + MO1-lratb.1	Fig. 6 from Isken et al., 2007
notochord undulate, abnormal	AB/TL + MO1-lratb.1	Fig. 6 from Isken et al., 2007
phosphatidylcholine-retinol O-acyltransferase activity disrupted, abnormal	AB/TL + MO1-lratb.1	Fig. 6 from Isken et al., 2007
somite increased size, abnormal	AB/TL + MO1-lratb.1	Fig. 6 from Isken et al., 2007
somite malformed, abnormal	AB/TL + MO1-lratb.1	Fig. 6 from Isken et al., 2007
whole organism decreased length, abnormal	AB/TL + MO1-lratb.1	Fig. 6 from Isken et al., 2007

Phenotype of all Fish created by or utilizing MO1-lratb.1

Phenotype	Fish	Conditions	Figures
somite increased size, abnormal	AB/TL + MO1-lratb.1	standard conditions	Fig. 6 from Isken et al., 2007
whole organism decreased length, abnormal	AB/TL + MO1-lratb.1	standard conditions	Fig. 6 from Isken et al., 2007
hindbrain malformed, abnormal	AB/TL + MO1-lratb.1	standard conditions	Fig. 6 from Isken et al., 2007
phosphatidylcholine-retinol O-acyltransferase activity disrupted, abnormal	AB/TL + MO1-lratb.1	standard conditions	Fig. 6 from Isken et al., 2007
eye malformed, abnormal	AB/TL + MO1-lratb.1	standard conditions	Fig. 6 from Isken et al., 2007
somite malformed, abnormal	AB/TL + MO1-lratb.1	standard conditions	Fig. 6 from Isken et al., 2007
notochord undulate, abnormal	AB/TL + MO1-lratb.1	standard conditions	Fig. 6 from Isken et al., 2007

Citations