Morpholino

MO1-msx3

ID

ZDB-MRPHLNO-070215-3

Name

MO1-msx3

Previous Names

MO1-msxc

Target

msx3 (1)

Sequence

5' - ATTATTGCTGAGGTGCTTACTTGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-msx3

No data available

Phenotype

Phenotype resulting from MO1-msx3

Phenotype	Fish	Figures
cartilage development disrupted, abnormal	AB + MO1-msx3	Fig. 6 from Phillips et al., 2006
cranial cartilage hypoplastic, abnormal	AB + MO1-msx3	Fig. 6 from Phillips et al., 2006
embryonic viscerocranium morphogenesis disrupted, abnormal	AB + MO1-msx3	Fig. 6 from Phillips et al., 2006
post-vent region curved ventral, abnormal	AB + MO1-msx3	Fig. 3 from Phillips et al., 2006

Phenotype of all Fish created by or utilizing MO1-msx3

Phenotype	Fish	Conditions	Figures
embryonic viscerocranium morphogenesis disrupted, abnormal	AB + MO1-msx3	standard conditions	Fig. 6 from Phillips et al., 2006
cranial cartilage hypoplastic, abnormal	AB + MO1-msx3	standard conditions	Fig. 6 from Phillips et al., 2006
post-vent region curved ventral, abnormal	AB + MO1-msx3	standard conditions	Fig. 3 from Phillips et al., 2006
cartilage development disrupted, abnormal	AB + MO1-msx3	standard conditions	Fig. 6 from Phillips et al., 2006
otic placode formation delayed, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 4 from Phillips et al., 2006
Rohon-Beard neuron decreased amount, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 6 from Phillips et al., 2006
otic vesicle decreased size, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 3 from Phillips et al., 2006
post-vent region wholly ventralized, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 3 from Phillips et al., 2006
post-vent region curved ventral, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 3 from Phillips et al., 2006
otic placode disorganized, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 4 from Phillips et al., 2006
cartilage development disrupted, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 6 from Phillips et al., 2006
embryonic viscerocranium morphogenesis disrupted, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 6 from Phillips et al., 2006
trigeminal ganglion decreased size, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 4 from Phillips et al., 2006
head apoptotic, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 3 from Phillips et al., 2006
inner ear development disrupted, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 4 from Phillips et al., 2006
cranial cartilage hypoplastic, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 6 from Phillips et al., 2006
apoptotic process increased rate, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	text only from Phillips et al., 2006
otic placode decreased size, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 4 from Phillips et al., 2006
inner ear auditory receptor cell differentiation delayed, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	text only from Phillips et al., 2006
neural crest cell migration disrupted, abnormal	AB + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	Fig. 6 from Phillips et al., 2006
otic placode decreased size, abnormal	Df(Chr01:lef1,msxb)x8/x8 + MO1-msx1a + MO1-msx3 + MO4-msx1b	standard conditions	text only from Phillips et al., 2006

Citations