Morpholino

MO1-ldb3a

ID
ZDB-MRPHLNO-061221-1
Name
MO1-ldb3a
Previous Names
  • cypher-MO (1)
  • MO1-ldb3
Target
Sequence
5' - AGTCATTGTTCAAAAAAGCCTTTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ldb3a
Phenotype
Phenotype resulting from MO1-ldb3a
Phenotype Fish Figures
atrium decreased thickness, abnormal WT + MO1-ldb3a Fig. 5 with image from van der Meer et al., 2006
atrium elongated, abnormal WT + MO1-ldb3a Fig. 5 with image from van der Meer et al., 2006
cardiac ventricle morphology, abnormal WT + MO1-ldb3a Fig. 4 with image from van der Meer et al., 2006
heart development disrupted, abnormal WT + MO1-ldb3a Fig. 5 with image from van der Meer et al., 2006
locomotion disrupted, abnormal WT + MO1-ldb3a Fig. 2 with image from Bührdel et al., 2015
myotome condensed, abnormal WT + MO1-ldb3a Fig. 3 with image from van der Meer et al., 2006
myotome deformed, abnormal WT + MO1-ldb3a Fig. 3 with image from van der Meer et al., 2006
notochord posterior region malformed, abnormal WT + MO1-ldb3a Fig. 3 with image from van der Meer et al., 2006
pericardium decreased thickness, abnormal WT + MO1-ldb3a Fig. 4 with image from van der Meer et al., 2006
pericardium edematous, abnormal WT + MO1-ldb3a Fig. S4 with image from Bührdel et al., 2015
Fig. 3 with imageFig. 4 with image from van der Meer et al., 2006
presumptive atrium heart tube elongated, abnormal WT + MO1-ldb3a Fig. 5 with image from van der Meer et al., 2006
skeletal muscle refractivity, abnormal WT + MO1-ldb3a Fig. S4 with image from Bührdel et al., 2015
somite condensed, abnormal WT + MO1-ldb3a Fig. 3 with image from van der Meer et al., 2006
somite deformed, abnormal WT + MO1-ldb3a Fig. 3 with image from van der Meer et al., 2006
somite disorganized, abnormal WT + MO1-ldb3a Fig. 4 with image from van der Meer et al., 2006
somite morphology, abnormal WT + MO1-ldb3a Fig. 4 with image from van der Meer et al., 2006
thigmotaxis disrupted, abnormal WT + MO1-ldb3a Fig. 2 with image from Bührdel et al., 2015
trunk curved, abnormal WT + MO1-ldb3a Fig. S4 with image from Bührdel et al., 2015
ventricular myocardium decreased size, abnormal WT + MO1-ldb3a Fig. 5 with image from van der Meer et al., 2006
ventricular myocardium disorganized, abnormal WT + MO1-ldb3a Fig. 5 with image from van der Meer et al., 2006
whole organism decreased mobility, abnormal WT + MO1-ldb3a Fig. 2 with image from Bührdel et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ldb3a Fig. 3 with image from van der Meer et al., 2006
Phenotype of all Fish created by or utilizing MO1-ldb3a
Phenotype Fish Conditions Figures
cardiac ventricle morphology, abnormal WT + MO1-ldb3a standard conditions Fig. 4 with image from van der Meer et al., 2006
atrium elongated, abnormal WT + MO1-ldb3a standard conditions Fig. 5 with image from van der Meer et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ldb3a standard conditions Fig. 3 with image from van der Meer et al., 2006
myotome deformed, abnormal WT + MO1-ldb3a standard conditions Fig. 3 with image from van der Meer et al., 2006
myotome condensed, abnormal WT + MO1-ldb3a standard conditions Fig. 3 with image from van der Meer et al., 2006
ventricular myocardium decreased size, abnormal WT + MO1-ldb3a standard conditions Fig. 5 with image from van der Meer et al., 2006
ventricular myocardium disorganized, abnormal WT + MO1-ldb3a standard conditions Fig. 5 with image from van der Meer et al., 2006
heart development disrupted, abnormal WT + MO1-ldb3a standard conditions Fig. 5 with image from van der Meer et al., 2006
skeletal muscle refractivity, abnormal WT + MO1-ldb3a standard conditions Fig. S4 with image from Bührdel et al., 2015
locomotion disrupted, abnormal WT + MO1-ldb3a standard conditions Fig. 2 with image from Bührdel et al., 2015
pericardium decreased thickness, abnormal WT + MO1-ldb3a standard conditions Fig. 4 with image from van der Meer et al., 2006
trunk curved, abnormal WT + MO1-ldb3a standard conditions Fig. S4 with image from Bührdel et al., 2015
notochord posterior region malformed, abnormal WT + MO1-ldb3a standard conditions Fig. 3 with image from van der Meer et al., 2006
somite morphology, abnormal WT + MO1-ldb3a standard conditions Fig. 4 with image from van der Meer et al., 2006
atrium decreased thickness, abnormal WT + MO1-ldb3a standard conditions Fig. 5 with image from van der Meer et al., 2006
presumptive atrium heart tube elongated, abnormal WT + MO1-ldb3a standard conditions Fig. 5 with image from van der Meer et al., 2006
somite condensed, abnormal WT + MO1-ldb3a standard conditions Fig. 3 with image from van der Meer et al., 2006
thigmotaxis disrupted, abnormal WT + MO1-ldb3a standard conditions Fig. 2 with image from Bührdel et al., 2015
somite deformed, abnormal WT + MO1-ldb3a standard conditions Fig. 3 with image from van der Meer et al., 2006
somite disorganized, abnormal WT + MO1-ldb3a standard conditions Fig. 4 with image from van der Meer et al., 2006
pericardium edematous, abnormal WT + MO1-ldb3a standard conditions Fig. S4 with image from Bührdel et al., 2015
Fig. 3 with imageFig. 4 with image from van der Meer et al., 2006
whole organism decreased mobility, abnormal WT + MO1-ldb3a standard conditions Fig. 2 with image from Bührdel et al., 2015
Citations