Morpholino

MO2-acvr1l

ID
ZDB-MRPHLNO-060920-2
Name
MO2-acvr1l
Previous Names
  • alk8 MO3 (1)
  • alk8morph2 (1)
  • MO2-acvr1 (1)
Target
Sequence
5' - GATTCATGTTTGTGTTCAATTTCCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-acvr1l
Phenotype
Phenotype resulting from MO2-acvr1l
Phenotype of all Fish created by or utilizing MO2-acvr1l
Phenotype Fish Conditions Figures
post-vent region truncated, abnormal WT + MO2-acvr1l standard conditions Fig. 2 with image from Bauer et al., 2001
whole organism wholly dorsalized, abnormal WT + MO2-acvr1l standard conditions Fig. 5 from Umasankar et al., 2012
Fig. 2 with image from Bauer et al., 2001
blastoderm ventral region Ab13-smad labeling decreased distribution, abnormal WT + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 2 with image from Allen et al., 2020
whole organism viability, abnormal WT + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 1 with image from Allen et al., 2020
whole organism dead, abnormal WT + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 1 with image from Allen et al., 2020
whole organism dorsalized, abnormal WT + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 1 with image from Allen et al., 2020
whole organism wholly dorsalized, abnormal WT + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 2 from Little et al., 2009
whole organism anterior-posterior axis increased length, abnormal WT + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 1 with image from Allen et al., 2020
whole organism wholly dorsalized, abnormal WT + MO1-fcho1 + MO2-acvr1l standard conditions Fig. 5 from Umasankar et al., 2012
ventral fin fold morphology, abnormal WT + MO1-fcho1 + MO2-acvr1l standard conditions Fig. 5 from Umasankar et al., 2012
presumptive rhombomere 5 egr2b expression increased distribution, abnormal bmpr1absa28/sa28; bmpr1aap3/p3 + MO1-bmpr1ba + MO1-bmpr1bb + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 6 with image from Allen et al., 2020
blastoderm ventral region Ab13-smad labeling decreased distribution, abnormal bmpr1absa28/sa28; bmpr1aap3/p3 + MO1-bmpr1ba + MO1-bmpr1bb + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 5 with image from Allen et al., 2020
pronephric mesoderm pax2a expression absent, abnormal bmpr1absa28/sa28; bmpr1aap3/p3 + MO1-bmpr1ba + MO1-bmpr1bb + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 6 with image from Allen et al., 2020
presumptive rhombomere 3 egr2b expression increased distribution, abnormal bmpr1absa28/sa28; bmpr1aap3/p3 + MO1-bmpr1ba + MO1-bmpr1bb + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 6 with image from Allen et al., 2020
midbrain hindbrain boundary neural rod pax2a expression increased distribution, abnormal bmpr1absa28/sa28; bmpr1aap3/p3 + MO1-bmpr1ba + MO1-bmpr1bb + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 6 with image from Allen et al., 2020
whole organism dorsalized, exacerbated bmpr1absa28/sa28; bmpr1aap3/p3 + MO1-bmpr1ba + MO1-bmpr1bb + MO2-acvr1l + MO4-acvr1l standard conditions Fig. 5 with image from Allen et al., 2020
Citations