Morpholino

MO1-lrp2a

ID

ZDB-MRPHLNO-060919-4

Name

MO1-lrp2a

Previous Names

megMO1 (1)
MO1-lrp2 (1)

Target

lrp2a (1)

Sequence

5' - AATCAGTGCTTGTGGTTTACCTGGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice-blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lrp2a

Expressed Gene	Anatomy	Figures
lrp2a	whole organism	Fig. 6 from Anzenberger et al., 2006
rab4a	retina	text only from Anzenberger et al., 2006

Phenotype

Phenotype resulting from MO1-lrp2a

Phenotype	Fish	Figures
atrium cardiac muscle cell decreased amount, abnormal	sd12Tg/sd12Tg + MO1-lrp2a	Figure 3 from Theis et al., 2020
cardiac ventricle decreased contractility, abnormal	AB + MO1-lrp2a	Figure 3 - figure supplement 1 from Theis et al., 2020
cardiac ventricle decreased size, abnormal	AB + MO1-lrp2a	Figure 3, Figure 3 - figure supplement 1 from Theis et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal	twu277Tg + MO1-lrp2a	Figure 3 from Theis et al., 2020
heart decreased size, abnormal	sd12Tg/sd12Tg + MO1-lrp2a	Figure 3 from Theis et al., 2020
heart morphology, abnormal	sd12Tg/sd12Tg + MO1-lrp2a	Figure 3 from Theis et al., 2020
heart contraction decreased rate, abnormal	AB + MO1-lrp2a	Figure 3 - figure supplement 1 from Theis et al., 2020
pericardium edematous, abnormal	AB + MO1-lrp2a	Figure 3 - figure supplement 1 from Theis et al., 2020
renal albumin absorption decreased occurrence, abnormal	rw0144Tg; zf2102Tg + MO1-lrp2a (AB)	Fig. 5 from Wan et al., 2016

Phenotype of all Fish created by or utilizing MO1-lrp2a

Phenotype	Fish	Conditions	Figures
cardiac ventricle decreased size, abnormal	sd12Tg/sd12Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
atrium cardiac muscle cell decreased amount, abnormal	sd12Tg/sd12Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
heart decreased size, abnormal	sd12Tg/sd12Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal	sd12Tg/sd12Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
heart morphology, abnormal	sd12Tg/sd12Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
cardiac ventricle decreased size, abnormal	AB + MO1-lrp2a	standard conditions	Figure 3 - figure supplement 1 from Theis et al., 2020
cardiac ventricle decreased contractility, abnormal	AB + MO1-lrp2a	standard conditions	Figure 3 - figure supplement 1 from Theis et al., 2020
pericardium edematous, abnormal	AB + MO1-lrp2a	standard conditions	Figure 3 - figure supplement 1 from Theis et al., 2020
heart contraction decreased rate, abnormal	AB + MO1-lrp2a	standard conditions	Figure 3 - figure supplement 1 from Theis et al., 2020
renal absorption disrupted, abnormal	WT + MO1-lrp2a	chemical treatment: fluorescein (lactone form)	Fig. 7 from Anzenberger et al., 2006
renal absorption arrested, abnormal	WT + MO1-lrp2a	chemical treatment: protein	Fig. 8 from Anzenberger et al., 2006
pronephric duct early endosome absent, abnormal	WT + MO1-lrp2a	chemical treatment: fluorescein (lactone form)	Fig. 9 from Anzenberger et al., 2006
receptor-mediated endocytosis disrupted, abnormal	WT + MO1-lrp2a	chemical treatment: fluorescein (lactone form)	Fig. 9 from Anzenberger et al., 2006
cardiac ventricle decreased size, abnormal	twu277Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
atrium cardiac muscle cell decreased amount, abnormal	twu277Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
heart decreased size, abnormal	twu277Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
heart morphology, abnormal	twu277Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal	twu277Tg + MO1-lrp2a	standard conditions	Figure 3 from Theis et al., 2020
renal albumin absorption decreased occurrence, abnormal	rw0144Tg; zf2102Tg + MO1-lrp2a (AB)	standard conditions	Fig. 5 from Wan et al., 2016
pericardium edematous, abnormal	WT + MO1-lrp2a + MO1-lrp2b	chemical treatment: cisplatin	Fig. 2 from McMahon et al., 2014
pronephros edematous, abnormal	WT + MO1-lrp2a + MO1-lrp2b	chemical treatment: gentamycin C1	Fig. 2 from McMahon et al., 2014
pronephric duct proximal region decreased functionality, abnormal	umc407Tg + MO1-lrp2a + MO4-tp53	standard conditions	Fig. 2 , Fig. 3 from Naylor et al., 2022
urine protein increased amount, abnormal	umc407Tg + MO1-lrp2a + MO4-tp53	standard conditions	Fig. 2 , Fig. 3 from Naylor et al., 2022
renal albumin absorption decreased occurrence, exacerbated	rw0144Tg; zf2102Tg; zf3005Tg + MO1-lrp2a (AB)	standard conditions	Fig. 5 from Wan et al., 2016
urine protein increased amount, exacerbated	rw0144Tg; zf2102Tg; zf3005Tg + MO1-lrp2a (AB)	standard conditions	Fig. 5 from Wan et al., 2016
pronephros EGFP expression increased amount, abnormal	rw0144Tg; zf2102Tg; zf3005Tg + MO1-lrp2a (AB)	standard conditions	Fig. 5 from Wan et al., 2016

Citations