Morpholino

MO1-dlx5a

ID
ZDB-MRPHLNO-060822-7
Name
MO1-dlx5a
Previous Names
None
Target
Sequence
5' - CGAATACTCCAGTCATAGTTTGGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocker.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dlx5a
Expressed Gene Anatomy Figures
gad1b Fig. S3 with image from MacDonald et al., 2013
Phenotype
Phenotype resulting from MO1-dlx5a
Phenotype Fish Figures
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx5a Fig. 1 with image from Talbot et al., 2010
symplectic decreased length, abnormal AB + MO1-dlx5a Fig. 1 with image from Talbot et al., 2010
Phenotype of all Fish created by or utilizing MO1-dlx5a
Phenotype Fish Conditions Figures
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx5a standard conditions Fig. 1 with image from Talbot et al., 2010
symplectic decreased length, abnormal AB + MO1-dlx5a standard conditions Fig. 1 with image from Talbot et al., 2010
regenerating fin caudal fin lepidotrichium increased length, abnormal C32 + MO1-dlx5a amputation Fig. 4 with image from Ton et al., 2013
olfactory bulb glomerulus aplastic/hypoplastic, abnormal rw037Tg + MO1-dlx5a + MO3-dlx5a standard conditions Fig. 4 from Garaffo et al., 2013
olfactory epithelium morphology, abnormal rw037Tg + MO1-dlx5a + MO3-dlx5a standard conditions Fig. 4 from Garaffo et al., 2013
olfactory nerve formation process quality, abnormal rw037Tg + MO1-dlx5a + MO3-dlx5a standard conditions Fig. 4 from Garaffo et al., 2013
cranial nerve I axon mislocalised, abnormal rw037Tg + MO1-dlx5a + MO3-dlx5a standard conditions Fig. 4 from Garaffo et al., 2013
interhyal-epihyal joint absent, abnormal WT + MO1-dlx3b + MO1-dlx5a standard conditions Fig. 3 with image from Walker et al., 2006
mandibular arch skeleton joint absent, abnormal WT + MO1-dlx3b + MO1-dlx5a standard conditions Fig. 3 with image from Walker et al., 2006
opercle fused with branchiostegal ray, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage decreased length, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage morphology, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
mandibular arch skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
pharyngeal arch 2 skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage tapered, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
ceratobranchial 5 tooth decreased size, abnormal WT + MO1-dlx2a + MO1-dlx2b + MO1-dlx5a + MO3-dlx3b standard conditions Fig. 5 with image from Jackman et al., 2006
ceratobranchial 5 tooth deformed, abnormal WT + MO1-dlx2a + MO1-dlx2b + MO1-dlx5a + MO3-dlx3b standard conditions Fig. 5 with image from Jackman et al., 2006
otolith fused with otolith, abnormal WT + MO1-dlx2a + MO1-dlx2b + MO1-dlx5a + MO3-dlx3b standard conditions text only from Jackman et al., 2006
pharyngeal arch cartilage hypoplastic, abnormal WT + MO1-dlx2a + MO1-dlx2b + MO1-dlx5a + MO3-dlx3b standard conditions text only from Jackman et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.