Morpholino

MO2-rhoab

ID

ZDB-MRPHLNO-060713-2

Name

MO2-rhoab

Previous Names

rhoA MO2 (1)

Target

rhoab (1)

Sequence

5' - CTAGCCGTTTTGTTTTAGTCCAACG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-rhoab

No data available

Phenotype

Phenotype resulting from MO2-rhoab

Phenotype	Fish	Figures
axis decreased length, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
convergent extension involved in axis elongation disrupted, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
convergent extension involved in gastrulation disrupted, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
extension decreased length, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
extension increased thickness, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
head decreased size, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
head mislocalised posteriorly, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
notochord decreased length, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
notochord increased width, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
notochord undulate, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
post-anal tail morphogenesis disrupted, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
post-vent region decreased length, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
somite condensed, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
somite increased width, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
somite malformed, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
somite border hypoplastic, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006
tail bud mislocalised, abnormal	WT + MO2-rhoab	Fig. 4 from Zhu et al., 2006

Phenotype of all Fish created by or utilizing MO2-rhoab

Phenotype	Fish	Conditions	Figures
notochord decreased length, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
post-vent region decreased length, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
notochord increased width, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
extension decreased length, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
notochord undulate, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
post-anal tail morphogenesis disrupted, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
somite malformed, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
somite increased width, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
convergent extension involved in gastrulation disrupted, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
tail bud mislocalised, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
head decreased size, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
somite border hypoplastic, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
convergent extension involved in axis elongation disrupted, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
head mislocalised posteriorly, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
somite condensed, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
extension increased thickness, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006
axis decreased length, abnormal	WT + MO2-rhoab	standard conditions	Fig. 4 from Zhu et al., 2006

Citations