Morpholino

MO1-otx2a

ID

ZDB-MRPHLNO-060620-5

Name

MO1-otx2a

Previous Names

MO1-otx1a
MO1-otx1l
Otx1-like MO-Fluo (1)

Target

otx2a (1)

Sequence

5' - GAGGTATGACATCATTGTTGAGCCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-otx2a

Expressed Gene	Anatomy	Figures
dct	neural crest melanocyte optic cup ventral-most region	Fig. 4 from Lane et al., 2012
mitfa	neural crest cell optic cup pigmented epithelial cell	Fig. 5 from Lane et al., 2012
mitfb	epiphysis optic cup pigmented epithelial cell	Fig. 5 from Lane et al., 2012

Phenotype

Phenotype resulting from MO1-otx2a

No data available

Phenotype of all Fish created by or utilizing MO1-otx2a

Phenotype	Fish	Conditions	Figures
eye perforate, abnormal	WT + MO1-otx1 + MO1-otx2a	standard conditions	Fig. 2 from Lane et al., 2012
optic fissure closure incomplete, abnormal	WT + MO1-otx1 + MO1-otx2a	standard conditions	Fig. 2 from Lane et al., 2012
retinal pigmented epithelium ventral region absent, abnormal	WT + MO1-otx1 + MO1-otx2a	standard conditions	Fig. 2 from Lane et al., 2012
retinal pigmented epithelium anterior side separated from retinal pigmented epithelium posterior side, abnormal	WT + MO1-otx1 + MO1-otx2a	standard conditions	Fig. 2 from Lane et al., 2012
eye pigmentation decreased occurrence, abnormal	WT + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 1 from Lane et al., 2012
retinal pigmented epithelium ventral region absent, abnormal	WT + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 3 from Lane et al., 2012
optic fissure closure incomplete, abnormal	WT + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 2 from Lane et al., 2012
eye perforate, abnormal	WT + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 1 , Fig. 2 from Lane et al., 2012
retinal pigmented epithelium anterior side separated from retinal pigmented epithelium posterior side, abnormal	WT + MO1-otx1 + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 2 from Lane et al., 2012
retinal pigmented epithelium ventral region absent, abnormal	WT + MO1-otx1 + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 2 from Lane et al., 2012
rhombomere pax6a expression increased distribution, abnormal	WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 11 from Albuixech-Crespo et al., 2017
forebrain pax6a expression increased distribution, abnormal	WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 11 from Albuixech-Crespo et al., 2017
hindbrain pax6a expression increased distribution, abnormal	WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 11 from Albuixech-Crespo et al., 2017
midbrain hindbrain boundary wnt1 expression absent, abnormal	WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 11 from Albuixech-Crespo et al., 2017
midbrain pax6a expression increased distribution, abnormal	WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 11 from Albuixech-Crespo et al., 2017
midbrain wnt1 expression decreased amount, abnormal	WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 11 from Albuixech-Crespo et al., 2017
zona limitans intrathalamica shha expression absent, abnormal	WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b	standard conditions	Fig. 11 from Albuixech-Crespo et al., 2017

Citations