Morpholino

MO1-slc40a1

ID

ZDB-MRPHLNO-060601-4

Name

MO1-slc40a1

Previous Names

None

Target

Sequence

5' - GGCTGTCCATTGTGCGTTTTTTATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-slc40a1

No data available

Phenotype

Phenotype resulting from MO1-slc40a1

Phenotype	Fish	Figures
blood cell decreased amount, abnormal	sd2Tg; y1Tg + MO1-slc40a1	Fig. Table 1, Fig. Table S7 from Eckfeldt et al., 2005
blood circulation arrested, abnormal	sd2Tg; y1Tg + MO1-slc40a1	Fig. Table S7 from Eckfeldt et al., 2005
dorsal longitudinal anastomotic vessel structure, abnormal	sd2Tg; y1Tg + MO1-slc40a1	Fig. Table S7 from Eckfeldt et al., 2005
embryonic hemopoiesis disrupted, abnormal	sd2Tg; y1Tg + MO1-slc40a1	Fig. Table 1, Fig. Table S7 from Eckfeldt et al., 2005
eye decreased pigmentation, abnormal	sd2Tg; y1Tg + MO1-slc40a1	Fig. Table S7 from Eckfeldt et al., 2005
intersegmental vessel decreased size, abnormal	sd2Tg; y1Tg + MO1-slc40a1	Fig. Table S7 from Eckfeldt et al., 2005
pigmentation disrupted, abnormal	sd2Tg; y1Tg + MO1-slc40a1	Fig. Table S7 from Eckfeldt et al., 2005
trunk decreased pigmentation, abnormal	sd2Tg; y1Tg + MO1-slc40a1	Fig. Table S7 from Eckfeldt et al., 2005
ventral fin fold kinked, abnormal	sd2Tg; y1Tg + MO1-slc40a1	Fig. Table S7 from Eckfeldt et al., 2005

Phenotype of all Fish created by or utilizing MO1-slc40a1

Phenotype	Fish	Conditions	Figures
embryonic hemopoiesis disrupted, abnormal	WT + MO1-slc40a1	standard conditions	Fig. Table 1 from Eckfeldt et al., 2005
blood cell decreased amount, abnormal	WT + MO1-slc40a1	standard conditions	Fig. Table 1 from Eckfeldt et al., 2005
pigmentation disrupted, abnormal	sd2Tg; y1Tg + MO1-slc40a1	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
eye decreased pigmentation, abnormal	sd2Tg; y1Tg + MO1-slc40a1	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
blood circulation arrested, abnormal	sd2Tg; y1Tg + MO1-slc40a1	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
intersegmental vessel decreased size, abnormal	sd2Tg; y1Tg + MO1-slc40a1	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
blood cell decreased amount, abnormal	sd2Tg; y1Tg + MO1-slc40a1	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
dorsal longitudinal anastomotic vessel structure, abnormal	sd2Tg; y1Tg + MO1-slc40a1	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
ventral fin fold kinked, abnormal	sd2Tg; y1Tg + MO1-slc40a1	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
trunk decreased pigmentation, abnormal	sd2Tg; y1Tg + MO1-slc40a1	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
embryonic hemopoiesis disrupted, abnormal	sd2Tg; y1Tg + MO1-slc40a1	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005

Citations