Morpholino

MO1-ccr7

ID

ZDB-MRPHLNO-060522-1

Name

MO1-ccr7

Previous Names

None

Target

Sequence

5' - ACCCATTTGGTGTTCAGTCATGTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ccr7

No data available

Phenotype

Phenotype resulting from MO1-ccr7

Phenotype	Fish	Figures
blood cell decreased amount, abnormal	WT + MO1-ccr7	Fig. Table 1, Fig. Table S7 from Eckfeldt et al., 2005
blood circulation arrested, abnormal	sd2Tg; y1Tg + MO1-ccr7	Fig. Table S7 from Eckfeldt et al., 2005
blood vessel remodeling disrupted, abnormal	sd2Tg; y1Tg + MO1-ccr7	Fig. Table S7 from Eckfeldt et al., 2005
common cardinal vein morphology, abnormal	sd2Tg; y1Tg + MO1-ccr7	Fig. Table S7 from Eckfeldt et al., 2005
embryonic hemopoiesis disrupted, abnormal	WT + MO1-ccr7	Fig. Table 1, Fig. Table S7 from Eckfeldt et al., 2005
eye decreased size, abnormal	sd2Tg; y1Tg + MO1-ccr7	Fig. Table S7 from Eckfeldt et al., 2005
head decreased size, abnormal	sd2Tg; y1Tg + MO1-ccr7	Fig. Table S7 from Eckfeldt et al., 2005
heart contraction decreased rate, abnormal	sd2Tg; y1Tg + MO1-ccr7	Fig. Table S7 from Eckfeldt et al., 2005
intersegmental vessel decreased size, abnormal	sd2Tg; y1Tg + MO1-ccr7	Fig. Table S7 from Eckfeldt et al., 2005

Phenotype of all Fish created by or utilizing MO1-ccr7

Phenotype	Fish	Conditions	Figures
embryonic hemopoiesis disrupted, abnormal	WT + MO1-ccr7	standard conditions	Fig. Table 1 from Eckfeldt et al., 2005
blood cell decreased amount, abnormal	WT + MO1-ccr7	standard conditions	Fig. Table 1 from Eckfeldt et al., 2005
blood cell decreased amount, abnormal	sd2Tg; y1Tg + MO1-ccr7	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
common cardinal vein morphology, abnormal	sd2Tg; y1Tg + MO1-ccr7	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
heart contraction decreased rate, abnormal	sd2Tg; y1Tg + MO1-ccr7	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
intersegmental vessel decreased size, abnormal	sd2Tg; y1Tg + MO1-ccr7	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
eye decreased size, abnormal	sd2Tg; y1Tg + MO1-ccr7	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
blood vessel remodeling disrupted, abnormal	sd2Tg; y1Tg + MO1-ccr7	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
blood circulation arrested, abnormal	sd2Tg; y1Tg + MO1-ccr7	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
head decreased size, abnormal	sd2Tg; y1Tg + MO1-ccr7	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005
embryonic hemopoiesis disrupted, abnormal	sd2Tg; y1Tg + MO1-ccr7	standard conditions	Fig. Table S7 from Eckfeldt et al., 2005

Citations