Morpholino

MO3-shhb

ID

ZDB-MRPHLNO-060508-2

Name

MO3-shhb

Previous Names

twhh-MO (1)

Target

shhb (1)

Sequence

5' - GCTTCAGATGCAGCCTTACGTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a subset of MO1-shhb, targeted to the translation start region.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-shhb

Expressed Gene	Anatomy	Figures
dbx1a	dorsal thalamus tegmentum zona limitans intrathalamica	Fig. 4 from Scholpp et al., 2006
dlx2a	ventral thalamus	Fig. 4 from Scholpp et al., 2006
ptch2	hypothalamus zona limitans intrathalamica	Fig. 4 from Scholpp et al., 2006

Phenotype

Phenotype resulting from MO3-shhb

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	WIK + MO3-shhb	text only from Hammond et al., 2003
somite morphology, abnormal	WIK + MO3-shhb	text only from Hammond et al., 2003

Phenotype of all Fish created by or utilizing MO3-shhb

Phenotype	Fish	Conditions	Figures
somite morphology, abnormal	Df(Chr07)t4/t4 + MO3-shhb	standard conditions	text only from Hammond et al., 2003
eye fused with eye, abnormal	Df(Chr07)t4/t4 + MO3-shhb	standard conditions	text only from Hammond et al., 2003
inner ear wholly anteriorized, abnormal	Df(Chr07)t4/t4 + MO3-shhb	standard conditions	Fig. 7 , text only from Hammond et al., 2003
otolith decreased size, abnormal	Df(Chr07)t4/t4 + MO3-shhb	standard conditions	Fig. 7 from Hammond et al., 2003
posterior macula aplastic, abnormal	Df(Chr07)t4/t4 + MO3-shhb	standard conditions	Fig. 7 , text only from Hammond et al., 2003
blood circulation disrupted, abnormal	Df(Chr07)t4/t4 + MO3-shhb	standard conditions	text only from Hammond et al., 2003
pars superior ear has extra parts of type anterior crista, abnormal	Df(Chr07)t4/t4 + MO3-shhb	standard conditions	Fig. 7 from Hammond et al., 2003
somite morphology, abnormal	WIK + MO3-shhb	standard conditions	text only from Hammond et al., 2003
blood circulation disrupted, abnormal	WIK + MO3-shhb	standard conditions	text only from Hammond et al., 2003
somite U-shaped, abnormal	WT + MO3-ihhb + MO3-shha + MO3-shhb	standard conditions	Fig. 2 from Lam et al., 2003
locus coeruleus neuron decreased amount, abnormal	WT + MO3-ihhb + MO3-shha + MO3-shhb	standard conditions	Fig. 2 from Lam et al., 2003
pericardium edematous, abnormal	WT + MO3-ihhb + MO3-shha + MO3-shhb	standard conditions	Fig. 2 from Lam et al., 2003
blood circulation disrupted, abnormal	WT + MO3-ihhb + MO3-shha + MO3-shhb	standard conditions	Fig. 2 from Lam et al., 2003

Citations