Morpholino

MO1-nrarpb

ID

ZDB-MRPHLNO-060214-4

Name

MO1-nrarpb

Previous Names

None

Target

nrarpb (1)

Sequence

5' - ATGATTTCAGCAGGTTGACCAAAACG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-nrarpb

No data available

Phenotype

Phenotype resulting from MO1-nrarpb

Phenotype	Fish	Figures
blood vessel development disrupted, abnormal	y1Tg + MO1-nrarpb	Fig. 3 from Phng et al., 2009
blood vessel endothelial cell migration disrupted, abnormal	y1Tg + MO1-nrarpb	Fig. 3 from Phng et al., 2009
blood vessel endothelial cell proliferation involved in sprouting angiogenesis disrupted, abnormal	y1Tg + MO1-nrarpb	Fig. 5 from Phng et al., 2009
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-nrarpb	Fig. 3 from Phng et al., 2009
intersegmental vessel malformed, abnormal	y1Tg + MO1-nrarpb	Fig. 3 from Phng et al., 2009
intersegmental vessel structure, abnormal	y1Tg + MO1-nrarpb	Fig. 3 from Phng et al., 2009

Phenotype of all Fish created by or utilizing MO1-nrarpb

Phenotype	Fish	Conditions	Figures
blood vessel development disrupted, abnormal	y1Tg + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009
intersegmental vessel structure, abnormal	y1Tg + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009
blood vessel endothelial cell proliferation involved in sprouting angiogenesis disrupted, abnormal	y1Tg + MO1-nrarpb	standard conditions	Fig. 5 from Phng et al., 2009
intersegmental vessel malformed, abnormal	y1Tg + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009
blood vessel endothelial cell migration disrupted, abnormal	y1Tg + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009
negative regulation of Notch signaling pathway disrupted, abnormal	WT + MO1-nrarpa + MO1-nrarpb	standard conditions	Fig. 5 from Ishitani et al., 2005
somitogenesis disrupted, abnormal	WT + MO1-nrarpa + MO1-nrarpb	standard conditions	Fig. 5 from Ishitani et al., 2005
neurogenesis disrupted, abnormal	WT + MO1-nrarpa + MO1-nrarpb	standard conditions	Fig. 5 from Ishitani et al., 2005
blood vessel development disrupted, abnormal	y1Tg + MO1-nrarpa + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009
intersegmental vessel malformed, abnormal	y1Tg + MO1-nrarpa + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009
intersegmental vessel structure, abnormal	y1Tg + MO1-nrarpa + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009
blood vessel endothelial cell migration disrupted, abnormal	y1Tg + MO1-nrarpa + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-nrarpa + MO1-nrarpb	standard conditions	Fig. 3 from Phng et al., 2009

Citations