Morpholino

MO1-nrarpa

ID
ZDB-MRPHLNO-060214-3
Name
MO1-nrarpa
Previous Names
None
Target
Sequence
5' - GATGCTTCACACTGGGAGAAACTCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nrarpa
Expressed Gene Anatomy Figures
crestin Fig. 2,  Fig. 3,  Fig. S2 from Ishitani et al., 2005
foxd3 Fig. 2 from Ishitani et al., 2005
mitfa Fig. 3 from Ishitani et al., 2005
Phenotype
Phenotype resulting from MO1-nrarpa
Phenotype Fish Figures
blood vessel development disrupted, abnormal y1Tg + MO1-nrarpa Fig. 3 with image from Phng et al., 2009
blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO1-nrarpa Fig. 3 with image from Phng et al., 2009
blood vessel endothelial cell proliferation involved in sprouting angiogenesis disrupted, abnormal y1Tg + MO1-nrarpa Fig. 5 with image from Phng et al., 2009
cartilage morphogenesis disrupted, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
caudal fin morphology, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
cell-cell junction organization disrupted, abnormal y1Tg + MO1-nrarpa Fig. 4 with image from Phng et al., 2009
cranial cartilage morphology, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
dorsal root ganglion decreased amount, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
intersegmental vessel decreased amount, abnormal y1Tg + MO1-nrarpa Fig. 3 with image from Phng et al., 2009
intersegmental vessel malformed, abnormal y1Tg + MO1-nrarpa Fig. 3 with image from Phng et al., 2009
intersegmental vessel structure, abnormal y1Tg + MO1-nrarpa Fig. 3 with image from Phng et al., 2009
melanocyte decreased amount, abnormal WT + MO1-nrarpa Fig. 3 from Ishitani et al., 2005
neural crest cell development disrupted, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
neural crest cell migration disrupted, abnormal WT + MO1-nrarpa Fig. 2 from Ishitani et al., 2005
pigment cell differentiation disrupted, abnormal WT + MO1-nrarpa Fig. 3 from Ishitani et al., 2005
pigmentation disrupted, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
post-anal tail morphogenesis disrupted, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
trunk neural crest cell decreased amount, abnormal w25Tg + MO1-nrarpa Fig. 3 from Ishitani et al., 2005
trunk neural crest cell positional polarity, abnormal WT + MO1-nrarpa Fig. 2 from Ishitani et al., 2005
whole organism decreased pigmentation, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
whole organism decreased size, abnormal WT + MO1-nrarpa Fig. 1 from Ishitani et al., 2005
Phenotype of all Fish created by or utilizing MO1-nrarpa
Phenotype Fish Conditions Figures
cranial cartilage morphology, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
whole organism decreased size, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
cartilage morphogenesis disrupted, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
pigmentation disrupted, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
whole organism decreased pigmentation, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
dorsal root ganglion decreased amount, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
post-anal tail morphogenesis disrupted, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
trunk neural crest cell positional polarity, abnormal WT + MO1-nrarpa standard conditions Fig. 2 from Ishitani et al., 2005
caudal fin morphology, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
melanocyte decreased amount, abnormal WT + MO1-nrarpa standard conditions Fig. 3 from Ishitani et al., 2005
neural crest cell migration disrupted, abnormal WT + MO1-nrarpa standard conditions Fig. 2 from Ishitani et al., 2005
pigment cell differentiation disrupted, abnormal WT + MO1-nrarpa standard conditions Fig. 3 from Ishitani et al., 2005
neural crest cell development disrupted, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal WT + MO1-nrarpa standard conditions Fig. 1 from Ishitani et al., 2005
trunk neural crest cell decreased amount, abnormal w25Tg + MO1-nrarpa standard conditions Fig. 3 from Ishitani et al., 2005
blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO1-nrarpa standard conditions Fig. 3 with image from Phng et al., 2009
intersegmental vessel structure, abnormal y1Tg + MO1-nrarpa standard conditions Fig. 3 with image from Phng et al., 2009
cell-cell junction organization disrupted, abnormal y1Tg + MO1-nrarpa standard conditions Fig. 4 with image from Phng et al., 2009
blood vessel development disrupted, abnormal y1Tg + MO1-nrarpa standard conditions Fig. 3 with image from Phng et al., 2009
blood vessel endothelial cell proliferation involved in sprouting angiogenesis disrupted, abnormal y1Tg + MO1-nrarpa standard conditions Fig. 5 with image from Phng et al., 2009
intersegmental vessel malformed, abnormal y1Tg + MO1-nrarpa standard conditions Fig. 3 with image from Phng et al., 2009
intersegmental vessel decreased amount, abnormal y1Tg + MO1-nrarpa standard conditions Fig. 3 with image from Phng et al., 2009
somitogenesis disrupted, abnormal WT + MO1-nrarpa + MO1-nrarpb standard conditions Fig. 5 from Ishitani et al., 2005
neurogenesis disrupted, abnormal WT + MO1-nrarpa + MO1-nrarpb standard conditions Fig. 5 from Ishitani et al., 2005
negative regulation of Notch signaling pathway disrupted, abnormal WT + MO1-nrarpa + MO1-nrarpb standard conditions Fig. 5 from Ishitani et al., 2005
intersegmental vessel structure, abnormal y1Tg + MO1-nrarpa + MO1-nrarpb standard conditions Fig. 3 with image from Phng et al., 2009
blood vessel development disrupted, abnormal y1Tg + MO1-nrarpa + MO1-nrarpb standard conditions Fig. 3 with image from Phng et al., 2009
intersegmental vessel malformed, abnormal y1Tg + MO1-nrarpa + MO1-nrarpb standard conditions Fig. 3 with image from Phng et al., 2009
blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO1-nrarpa + MO1-nrarpb standard conditions Fig. 3 with image from Phng et al., 2009
intersegmental vessel decreased amount, abnormal y1Tg + MO1-nrarpa + MO1-nrarpb standard conditions Fig. 3 with image from Phng et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.