Morpholino

MO1-zfpm1

ID
ZDB-MRPHLNO-060130-1
Name
MO1-zfpm1
Previous Names
  • fog1 MO
Target
Sequence
5' - GATCCGTCCTCCGAGGCGACTAGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets 5' UTR of zfpm1.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-zfpm1
Expressed Gene Anatomy Figures
myl7 Fig. 5 with image from Walton et al., 2006
tbx5a Fig. 7 with image from Walton et al., 2006
tbx20 Fig. 7 with image from Walton et al., 2006
Phenotype
Phenotype resulting from MO1-zfpm1
Phenotype Fish Figures
atrium dilated, abnormal WT + MO1-zfpm1 Fig. 6 with image from Walton et al., 2006
atrium increased accumulation blood, abnormal WT + MO1-zfpm1 Fig. 5 with image,  Fig. 8 with image from Walton et al., 2006
cardiac ventricle dilated, abnormal WT + MO1-zfpm1 Fig. 6 with image from Walton et al., 2006
heart decreased functionality, abnormal WT + MO1-zfpm1 Fig. 6 with image from Walton et al., 2006
heart linear, abnormal WT + MO1-zfpm1 Fig. 5 with image from Walton et al., 2006
heart looping arrested, abnormal WT + MO1-zfpm1 Fig. 5 with image from Walton et al., 2006
nucleate erythrocyte decreased amount, abnormal WT + MO1-zfpm1 Fig. 5 with image from Walton et al., 2006
pericardium edematous, abnormal WT + MO1-zfpm1 Fig. 5 with image,  Fig. 6 with image,  Fig. 8 with image from Walton et al., 2006
ventricular myocardium decreased thickness, abnormal WT + MO1-zfpm1 Fig. 6 with image from Walton et al., 2006
ventricular myocardium hypoplastic, abnormal WT + MO1-zfpm1 Fig. 6 with image from Walton et al., 2006
yolk increased accumulation blood, abnormal WT + MO1-zfpm1 Fig. 8 with image from Walton et al., 2006
Phenotype of all Fish created by or utilizing MO1-zfpm1
Phenotype Fish Conditions Figures
heart decreased functionality, abnormal WT + MO1-zfpm1 standard conditions Fig. 6 with image from Walton et al., 2006
heart looping arrested, abnormal WT + MO1-zfpm1 standard conditions Fig. 5 with image from Walton et al., 2006
atrium increased accumulation blood, abnormal WT + MO1-zfpm1 standard conditions Fig. 5 with image,  Fig. 8 with image from Walton et al., 2006
pericardium edematous, abnormal WT + MO1-zfpm1 standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. 8 with image from Walton et al., 2006
ventricular myocardium decreased thickness, abnormal WT + MO1-zfpm1 standard conditions Fig. 6 with image from Walton et al., 2006
ventricular myocardium hypoplastic, abnormal WT + MO1-zfpm1 standard conditions Fig. 6 with image from Walton et al., 2006
nucleate erythrocyte decreased amount, abnormal WT + MO1-zfpm1 standard conditions Fig. 5 with image from Walton et al., 2006
heart linear, abnormal WT + MO1-zfpm1 standard conditions Fig. 5 with image from Walton et al., 2006
atrium dilated, abnormal WT + MO1-zfpm1 standard conditions Fig. 6 with image from Walton et al., 2006
cardiac ventricle dilated, abnormal WT + MO1-zfpm1 standard conditions Fig. 6 with image from Walton et al., 2006
yolk increased accumulation blood, abnormal WT + MO1-zfpm1 standard conditions Fig. 8 with image from Walton et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.