Morpholino

MO1-lama1

ID

ZDB-MRPHLNO-060119-1

Name

MO1-lama1

Previous Names

lama1 MO1 (1)

Target

lama1 (1)

Sequence

5' - ATCTCCATCATCGCTCAAACTAAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lama1

No data available

Phenotype

Phenotype resulting from MO1-lama1

Phenotype	Fish	Figures
central nervous system morphology, abnormal	WT + MO1-lama1	Fig. 3 from Sztal et al., 2012
facial nerve motor nucleus motor neuron mislocalised, abnormal	rw0Tg + MO1-lama1	Fig. 6 , Fig. 7 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	rw0Tg + MO1-lama1	Fig. 6 , Fig. 7 from Sittaramane et al., 2009
notochord morphology, abnormal	WT + MO1-lama1	Fig. 3 from Sztal et al., 2012
somite U-shaped, abnormal	WT + MO1-lama1	Fig. 3 from Sztal et al., 2012

Phenotype of all Fish created by or utilizing MO1-lama1

Phenotype	Fish	Conditions	Figures
notochord morphology, abnormal	WT + MO1-lama1	standard conditions	Fig. 3 from Sztal et al., 2012
somite U-shaped, abnormal	WT + MO1-lama1	standard conditions	Fig. 3 from Sztal et al., 2012
central nervous system morphology, abnormal	WT + MO1-lama1	standard conditions	Fig. 3 from Sztal et al., 2012
facial nerve motor nucleus motor neuron mislocalised, abnormal	rw0Tg + MO1-lama1	standard conditions	Fig. 6 , Fig. 7 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	rw0Tg + MO1-lama1	standard conditions	Fig. 6 , Fig. 7 from Sittaramane et al., 2009
myotome refractivity, abnormal	lama2^{teg15a/teg15a} + MO1-lama1	standard conditions	Fig. 3 from Sztal et al., 2012
somite U-shaped, abnormal	lama2^{teg15a/teg15a} + MO1-lama1	standard conditions	Fig. 3 from Sztal et al., 2012
notochord morphology, abnormal	lama2^{teg15a/teg15a} + MO1-lama1	standard conditions	Fig. 3 from Sztal et al., 2012
central nervous system morphology, abnormal	lama2^{teg15a/teg15a} + MO1-lama1	standard conditions	Fig. 3 from Sztal et al., 2012
slow muscle cell detached from myoseptum, abnormal	lama2^{teg15a/teg15a} + MO1-lama1	standard conditions	Fig. 3 from Sztal et al., 2012
intersegmental vessel decreased length, abnormal	WT + MO1-lama1 + MO1-lama4	standard conditions	Fig. 8 from Pollard et al., 2006
angiogenesis disrupted, abnormal	WT + MO1-lama1 + MO1-lama4	standard conditions	Fig. 8 from Pollard et al., 2006
neuron migration disrupted, abnormal	rw0Tg + MO1-cntn2 + MO1-lama1	standard conditions	Fig. 7 from Sittaramane et al., 2009
facial nerve motor nucleus motor neuron mislocalised, abnormal	rw0Tg + MO1-cntn2 + MO1-lama1	standard conditions	Fig. 7 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	rw0Tg + MO1-lama1 + MO1-vangl2	standard conditions	Fig. 6 from Sittaramane et al., 2009
facial nerve motor nucleus motor neuron mislocalised, abnormal	rw0Tg + MO1-lama1 + MO1-vangl2	standard conditions	Fig. 6 from Sittaramane et al., 2009
slow muscle cell detached from myoseptum, abnormal	lama2^{teg15a/teg15a}; i108Tg + MO1-lama1	standard conditions	Fig. 3 from Sztal et al., 2012
facial nerve motor nucleus motor neuron mislocalised, abnormal	vangl2^tc240/+; rw0Tg + MO1-lama1	standard conditions	Fig. 6 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	vangl2^tc240/+; rw0Tg + MO1-lama1	standard conditions	Fig. 6 from Sittaramane et al., 2009

Citations