Morpholino

MO1-dag1

ID
ZDB-MRPHLNO-051215-1
Name
MO1-dag1
Previous Names
None
Target
Sequence
5' - CATGCCTGCTTTTATTTTCCCTCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dag1
Expressed Gene Anatomy Figures
dag1 Fig. 6 from Carss et al., 2013
Fig. 3,  Fig. 4 from Lin et al., 2011
Fig. 5 from Moore et al., 2008
Fig. 2 with image,  Fig. 3 with image from Parsons et al., 2002
dmd Fig. 3 with image from Parsons et al., 2002
ihhb Fig. 2 from Lin et al., 2011
itga6a Fig. 4 with image from Goody et al., 2012
pxna Fig. 6 with image from Goody et al., 2012
Phenotype
Phenotype resulting from MO1-dag1
Phenotype Fish Figures
caudal fin kinked, abnormal WT + MO1-dag1 Fig. 5 from Moore et al., 2008
dorsal aorta intersegmental vessel separated from dorsal longitudinal anastomotic vessel, abnormal y1Tg + MO1-dag1 Fig. 5 from Wood et al., 2011
embryo development delayed, abnormal y1Tg + MO1-dag1 Fig. 2 from Wood et al., 2011
Fig. 2 with image from Parsons et al., 2002
larval locomotory behavior disrupted, abnormal y1Tg + MO1-dag1 Fig. 2 from Wood et al., 2011
locomotion involved in locomotory behavior decreased rate, abnormal WT + MO1-dag1 Fig. 8 with image from Goody et al., 2012
muscle disorganized, abnormal WT + MO1-dag1 Fig. 4 with image from Parsons et al., 2002
muscle necrotic, abnormal WT + MO1-dag1 Fig. 4 with image from Parsons et al., 2002
muscle sarcomere decreased amount, abnormal WT + MO1-dag1 Fig. 4 with image from Parsons et al., 2002
muscle sarcomere morphology, abnormal WT + MO1-dag1 Fig. 4 with image from Parsons et al., 2002
muscle sarcoplasmic reticulum unstructured, abnormal WT + MO1-dag1 Fig. 4 with image from Parsons et al., 2002
muscle attachment disrupted, abnormal WT + MO1-dag1 Fig. S2 with image from Postel et al., 2008
musculoskeletal movement disrupted, abnormal WT + MO1-dag1 Fig. 2 with image from Parsons et al., 2002
myoseptum broken, abnormal WT + MO1-dag1 Fig. 4 with image from Goody et al., 2010
myotome basement membrane malformed, abnormal WT + MO1-dag1 Fig. 2 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO1-dag1 Fig. 2 with image,  Fig. 6 with image from Goody et al., 2012
myotome muscle tendon junction disorganized, abnormal WT + MO1-dag1 Fig. 1 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-dag1 Fig. 1 with image from Goody et al., 2012
post-vent region decreased length, abnormal y1Tg + MO1-dag1 Fig. 2 from Wood et al., 2011
post-vent region increased curvature, abnormal WT + MO1-dag1 Fig. 2 with image from Parsons et al., 2002
post-vent region muscle cell morphology, abnormal WT + MO1-dag1 Fig. 5 from Lefebvre et al., 2007
somite intersegmental vessel absent, abnormal y1Tg + MO1-dag1 Fig. 5 from Wood et al., 2011
somite intersegmental vessel disorganized, abnormal y1Tg + MO1-dag1 Fig. 5 from Wood et al., 2011
somite myoseptum deformed, abnormal y1Tg + MO1-dag1 Fig. 4 from Wood et al., 2011
trunk musculature skeletal muscle cell retracted, abnormal WT + MO1-dag1 Fig. S2 with image from Postel et al., 2008
ventral fin fold decreased size, abnormal WT + MO1-dag1 Fig. 2 with image from Parsons et al., 2002
vertical myoseptum malformed, abnormal WT + MO1-dag1 Fig. 1 with image from Goody et al., 2012
vertical myoseptum basement membrane irregular spatial pattern, abnormal WT + MO1-dag1 Fig. 6 with image from Goody et al., 2012
whole organism dead, abnormal y1Tg + MO1-dag1 Fig. 2 from Wood et al., 2011
whole organism dystrophic, abnormal WT + MO1-dag1 Fig. 2 with image from Parsons et al., 2002
Phenotype of all Fish created by or utilizing MO1-dag1
Phenotype Fish Conditions Figures
skeletal muscle neuromuscular junction morphology, abnormal AB + MO1-dag1 + MO2-dag1 standard conditions Fig. 6 with image from Bailey et al., 2019
skeletal muscle neuromuscular junction morphology, abnormal AB + MO1-dag1 + MO2-dag1 chemical treatment by environment: NAD Fig. 6 with image from Bailey et al., 2019
embryo development delayed, abnormal WT + MO1-dag1 standard conditions Fig. 2 with image from Parsons et al., 2002
caudal fin kinked, abnormal WT + MO1-dag1 standard conditions Fig. 5 from Moore et al., 2008
myotome muscle tendon junction malformed, abnormal WT + MO1-dag1 standard conditions Fig. 1 with image from Goody et al., 2012
vertical myoseptum malformed, abnormal WT + MO1-dag1 standard conditions Fig. 1 with image from Goody et al., 2012
vertical myoseptum basement membrane irregular spatial pattern, abnormal WT + MO1-dag1 standard conditions Fig. 6 with image from Goody et al., 2012
musculoskeletal movement disrupted, abnormal WT + MO1-dag1 standard conditions Fig. 2 with image from Parsons et al., 2002
post-vent region muscle cell morphology, abnormal WT + MO1-dag1 standard conditions Fig. 5 from Lefebvre et al., 2007
muscle disorganized, abnormal WT + MO1-dag1 standard conditions Fig. 4 with image from Parsons et al., 2002
muscle necrotic, abnormal WT + MO1-dag1 standard conditions Fig. 4 with image from Parsons et al., 2002
post-vent region increased curvature, abnormal WT + MO1-dag1 standard conditions Fig. 2 with image from Parsons et al., 2002
muscle sarcomere morphology, abnormal WT + MO1-dag1 standard conditions Fig. 4 with image from Parsons et al., 2002
myotome basement membrane morphology, ameliorated WT + MO1-dag1 chemical treatment: NAD(+) Fig. 2 with image from Goody et al., 2012
locomotion involved in locomotory behavior decreased rate, abnormal WT + MO1-dag1 standard conditions Fig. 8 with image from Goody et al., 2012
muscle sarcomere decreased amount, abnormal WT + MO1-dag1 standard conditions Fig. 4 with image from Parsons et al., 2002
myoseptum broken, abnormal WT + MO1-dag1 standard conditions Fig. 4 with image from Goody et al., 2010
myotome muscle tendon junction disorganized, abnormal WT + MO1-dag1 standard conditions Fig. 1 with image from Goody et al., 2012
muscle sarcoplasmic reticulum unstructured, abnormal WT + MO1-dag1 standard conditions Fig. 4 with image from Parsons et al., 2002
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO1-dag1 standard conditions Fig. 2 with image,  Fig. 6 with image from Goody et al., 2012
whole organism dystrophic, abnormal WT + MO1-dag1 standard conditions Fig. 2 with image from Parsons et al., 2002
ventral fin fold decreased size, abnormal WT + MO1-dag1 standard conditions Fig. 2 with image from Parsons et al., 2002
muscle attachment disrupted, abnormal WT + MO1-dag1 standard conditions Fig. S2 with image from Postel et al., 2008
locomotion involved in locomotory behavior decreased rate, abnormal WT + MO1-dag1 chemical treatment: NAD(+) Fig. 8 with image from Goody et al., 2012
trunk musculature skeletal muscle cell retracted, abnormal WT + MO1-dag1 standard conditions Fig. S2 with image from Postel et al., 2008
myotome muscle cell attached to myotome muscle tendon junction, ameliorated WT + MO1-dag1 chemical treatment: NAD(+) Fig. 2 with image from Goody et al., 2012
myotome basement membrane malformed, abnormal WT + MO1-dag1 standard conditions Fig. 2 with image from Goody et al., 2012
embryo development delayed, abnormal y1Tg + MO1-dag1 standard conditions Fig. 2 from Wood et al., 2011
somite intersegmental vessel absent, abnormal y1Tg + MO1-dag1 standard conditions Fig. 5 from Wood et al., 2011
larval locomotory behavior disrupted, abnormal y1Tg + MO1-dag1 standard conditions Fig. 2 from Wood et al., 2011
somite myoseptum deformed, abnormal y1Tg + MO1-dag1 standard conditions Fig. 4 from Wood et al., 2011
somite intersegmental vessel disorganized, abnormal y1Tg + MO1-dag1 standard conditions Fig. 5 from Wood et al., 2011
whole organism dead, abnormal y1Tg + MO1-dag1 standard conditions Fig. 2 from Wood et al., 2011
post-vent region decreased length, abnormal y1Tg + MO1-dag1 standard conditions Fig. 2 from Wood et al., 2011
dorsal aorta intersegmental vessel separated from dorsal longitudinal anastomotic vessel, abnormal y1Tg + MO1-dag1 standard conditions Fig. 5 from Wood et al., 2011
post-vent region skeletal muscle cell retracted, abnormal ilkhu801/hu801 + MO1-dag1 standard conditions Fig. 1 with image from Postel et al., 2008
muscle attachment disrupted, abnormal ilkhu801/hu801 + MO1-dag1 standard conditions Fig. 1 with image from Postel et al., 2008
receptor clustering disrupted, abnormal musktbr307/tbr307 + MO1-dag1 standard conditions Fig. 3 from Lefebvre et al., 2007
skeletal muscle cell detached from vertical myoseptum, abnormal AB/TU + MO1-dag1 + MO1-lama2 standard conditions Fig. 6 with image from Charvet et al., 2013
muscle attachment decreased process quality, abnormal AB/TU + MO1-dag1 + MO1-lama2 standard conditions Fig. 6 with image from Charvet et al., 2013
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a chemical treatment: NAD(+) Fig. 5 with image from Goody et al., 2012
vertical myoseptum U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a chemical treatment: NAD(+) Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO1-itga6a + MO2-itga6a chemical treatment: NAD(+) Fig. 5 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
vertical myoseptum malformed, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
vertical myoseptum malformed, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
locomotion involved in locomotory behavior decreased rate, abnormal mai1Tg + MO1-dag1 standard conditions Fig. 8 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal mai1Tg + MO1-dag1 standard conditions Fig. 6 with image from Goody et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.